WO2011064437A2 - Viral vectors and methods used in the preparation of gdnf - Google Patents

Abstract

The invention relates to a method for the production and purification of recombinant human GDNF or a functionally equivalent variant thereof, using eukaryotic cells that contain an alphavirus vector comprising a sequence encoding recombinant human GDNF or a functionally equivalent variant thereof, operably linked to the subgenomic promoter which directs the expression of the protein in a suitable expression host. The invention also relates to alphavirus vectors and eukaryotic cells containing said alphavirus vectors.

Description

 VIRAL VECTORS AND USEFUL PROCEDURES IN THE PREPARATION OF

 GDNF

Field of the Invention

The present invention relates to genetic engineering and, in particular, to methods for the production of human glia-derived neurotrophic factor (GDNF) and alphavirus expression vectors. Background of the invention

The glia-derived neurotrophic factor (GDNF) was first described by Lin et al. 1993, as a potent neurotrophic factor for dopaminergic neurons. The gene for human GDNF encodes a mature protein of 134 amino acids with a molecular weight of 15 kDa that is forming a homodimer (30 kDa) linked by disulfide bridges. Based on the amino acid sequence, it has a pl of 9.26, the pH at which the protein has an equal number of positive charges and negative charges. Considering that GDNF is a highly glycosylated protein, its apparent molecular mass in an SDS-PAGE gel under reducing conditions varies between 18 and 22 kDa (Lin et al., 1993). In fact, N-glycosylations represent approximately 20-30% of the molecular mass of GDNF. GDNF is a protein with great therapeutic potential for the treatment of Parkinson's disease, from English "Parkinson's disease" (PD), amyotrophic lateral sclerosis, spinal cord injuries, peripheral nerve injury, including motor nerves such as the facial nerve, sensory nerves and mixed motors such as the sciatic nerve, eye diseases such as glaucoma, or induced retinal ganglion cell degeneration after optic nerve transection and other models of retinal degeneration. In addition, GDNF plays a key role in the negative regulation of drugs of abuse, including psychostimulants, morphine and alcohol. Glycosylation is one of the most common post-translational modifications of proteins that can affect their properties necessary for therapeutic application (Walsh and Jefferis, 2006). The presence and nature of an oligosaccharide chain can affect folding, stability, diffusion, immunity, ligand binding, biological, pharmacodynamic and pharmacokinetic half-life, as well as the functional activity of glycoproteins. Glycosylation seems to play an important role in the stability of GDNF.

Among the different systems for producing recombinant proteins, the most suitable for a therapeutic strategy would be a method that produces glycosylated GDNF. Since bacterial systems lack the ability to glycosylate proteins, the expression of glycosylated GDNF will require the use of eukaryotic cells. Among them, mammalian cells are the best candidates, as they will be able to introduce the same glycosylation pattern present in endogenous GDNF. Mammalian cells are the ideal expression system for producing structurally complex proteins, since they offer the highest degree of fidelity of the product necessary for a therapeutic agent (Walsh and Jefferis, 2006).

Currently, commercially available recombinant human GDNF has been produced in E. coli, and therefore is not glycosylated. A truncated human GDNF is also commercially available, lacking 31 residues of the amino terminal end of the amino acid sequence, which has been produced in NSO murine myeloma cells. Therefore, there is a need to develop methods and means that allow the preparation of glycosylated human GDNF.

Various failed attempts have been made to obtain glycosylated human GDNF using BHK cells transfected with the hGDNF gene and human dermal fibroblasts immortalized and transduced with a lentiviral vector containing hGDNF (pCCL-WPS-hGDNF). Quantities Insufficient and very low yields of the hGDNF obtained, as well as the copurification of the IGFBP-5 or IGFBP-7 contaminating proteins, represent the main drawback of these methods. IGFBP-5 and IGFBP-7 are insulin-like growth factor binding proteins with a molecular weight of 30 kDa and a theoretical pl of 8, 6 and 8, 3, respectively. These characteristics are very similar to those of the hGDNF dimer, resulting in an overlap of their corresponding peaks in the chromatogram, thus making the isolation of hGDNF difficult.

An objective of the present invention is to provide methods and means that allow the preparation of glycosylated hGDNF in optimal yields.

An objective of the present invention is to provide methods and means that allow the preparation of glycosylated hGDNF in an industrial scale manner. An object of the present invention is to provide methods and means that allow the preparation of glycosylated hGDNF directly in a pure form.

An objective of the present invention is to provide methods and means that allow the preparation of glycosylated hGDNF having eliminated possible contaminating proteins.

Blasey et al., 2000 describe the construction of plasmid pSFVl-hCOX-2. COX-2, also known as cyclooxygenase 2, is the key enzyme in the biosynthesis of prostaglandins. It is a cytoplasmic protein.

Lundstrom (Methods in Molecular Medicine, vol. 76: Viral Vectors for Gene Therapy: Methods and Protocols, Edited by: CA Machida © Humana Press Inc., Toto a, NJ) also provides specific examples of SFV vectors comprising a nucleotide sequence encoding polypeptides recombinants, such as the pSFV-5-HT3 mouse serotonin receptor vector or pSFV-CAP-hNKIRhi s, where the complete capsid gene is fused to the human neuroquinine-1 receptor gene (hNKl-R).

EP1386926A1 (Bioxtal) describes an alphavirus vector comprising a nucleic acid molecule or a construct comprising the sequence of a recombinant alphavirus genome, said recombinant alphavirus genome (i) being deficient in at least one gene encoding structural proteins of alphavirus, (ii) comprising coding sequences and non-structural protein regulatory sequences of the alphavirus, and (iii) comprising a nucleic acid sequence encoding the polypeptide.

Forsman et al., 2000 describes the vectors pSFVl-hUGTlA6 and pSFVl-hUGTlA9.

WO09 / 089040 (Jaffrey and Hengst) describes methods for expressing proteins in the axons of mammalian neurons.

The inventors have devised a method for the expression and purification of glycosylated hGDNF that prevents the production of contaminating proteins. This method allows the production of glycosylated hGDNF with superior yields and purity. The method is also suitable for the industrial scale production of hGDNF.

Summary Description of the Invention

 The present invention relates to a method for the production of a recombinant human GDNF protein, or a functionally equivalent variant thereof, comprising:

a) providing eukaryotic cells comprising an alphavirus expression vector, said vector comprising the nucleic acids of i) a 5 'sequence capable of directing the replication of the alphavirus; ii) a sequence encoding non-structural proteins capable of directing the replication of alphaviral RNA; iii) a subgenomic promoter of the alphavirus; iv) a sequence encoding a recombinant human GDNF protein, or a functionally equivalent variant thereof, operatively linked to the subgenomic promoter that directs protein expression in eukaryotic cells; v) a 3 'sequence capable of directing the replication of the alphavirus;

b) culturing or incubating said eukaryotic cells in a culture medium until the synthesis of cellular proteins is inhibited;

c) remove the supernatant;

d) culturing or incubating said eukaryotic cells in a culture medium for a period of time, so that the expression of the recombinant GDNF is achieved, but without cell death; Y

e) extract the recombinant GDNF protein from the culture medium.

The present invention also relates to an alphavirus expression vector as defined above, an alphaviral particle comprising the nucleic acids defined above in the form of RNA, and a eukaryotic cell comprising an alphavirus vector according to any of the embodiments presented in this document. The present invention also relates to fusion proteins comprising the SFV capsid protein bound to human GDNF, or a functionally equivalent variant thereof; or comprising at least the first 34 amino acids of the SFV capsid protein bound to a self-cleavage protease, the latter also bound to human GDNF, or a functionally equivalent variant thereof.

The present invention also relates to a composition comprising human GDNF or a functionally equivalent variant of GDNF wherein the GDNF is glycosylated and wherein the composition

(i) comprises a percentage of GDNF by weight with with respect to the total protein in the composition greater than 90% and / or

 (ii) is substantially free of IGFBP-4,

 IGFBP-5 and / or IGFBP-7.

Additionally, the invention relates to a composition according to the invention for use in medicine as well as for use in the treatment or prevention of a neurodegenerative disorder.

Description of the invention

 Viral vector of the invention

 The present invention relates to an alphavirus expression vector comprising nucleic acids of:

 - a 5 'sequence capable of directing the replication of the alphavirus,

 - a sequence coding for non-structural proteins capable of directing the replication of alphaviral RNA,

 - a subgenomic promoter (SG) of the alphavirus,

 - a sequence encoding a recombinant human GDNF protein, or a functionally equivalent variant thereof, operably linked to the subgenomic promoter that directs the expression of the protein in a suitable expression host,

 - a 3 'sequence capable of directing the replication of the alphavirus.

The term "alphavirus expression vector" refers to any nucleic acid molecule that comprises a recombinant alphavirus genome that comprises a nucleic acid sequence encoding human GDNF. The nucleic acid molecule can be a plasmid or a linear fragment, in the form of single stranded DNA or RNA. Preferably, the nucleic acid molecule is a plasmid DNA or a linear fragment in the form of RNA. The term "alphavirus vector" also includes recombinant alphaviruses, that is, alphavirus particles that comprise a nucleic acid molecule as described above. In one embodiment, the alphavirus expression vector is one with the sequence of SEQ ID NO. 1. The alphavirus vector can have different origins, Aura virus, Babanki virus, Barmah Forest virus, Bebaru virus, Buggy Creek virus, Chikungunya virus, Eastern equine encephalitis virus, Everglades virus, Fort Morgan, Getah virus, Highlands J virus, Kyzylagach virus, Mayaro virus, Mi dde lburg virus, Mucambo virus, Ndumu virus, O'Neong-Nyong virus, Pixuna virus, Ross River virus , Sagiyama virus, Semliki Forest virus, Sindbis virus, South African arbovirus No. 86, Una virus, Venezuelan equine encephalitis virus, West equine encephalitis virus and Whataroa virus.

Preferably, the alphavirus vectors are derived from the Semliki Forest virus (SFV) (Liljestróm and Garoff (1991) Sindbis virus (SIN) (Xiong et al. (1989) Science 243, 1188-1191), or equine encephalitis virus Venezuelan (VEE) (Pushko et al. (1997) Virology 239, 389-401).

The structure and sequence of alphavirus genomes is known in the prior art (see, for example, US Patent No. 5,739,026, which is incorporated by reference). Briefly, the genome comprises sequences that encode non-structural proteins (nsPs), sequences that encode structural proteins (e.g., the capsid, envelope proteins, etc.), as well as regulatory sequences necessary for replication and packaging.

The main regulatory sequences necessary for replication are located at the terminal ends of the genome (usually in the first and last 250 nucleotides). In this aspect, the terms "sequence 5 'capable of directing the replication of the alphavirus" and "sequence 3' capable of directing the replication of the alphavirus" refer to these extremes genome terminals In particular, the 3 'sequence capable of directing the replication of the alphavirus also includes a terminal sequence of polyadenins (Poly A). The term "a sequence coding for non-structural proteins capable of directing the replication of alphaviral RNA" refers to the nsPl-4 polypeptide, which is subsequently divided into four separate proteins. The alphavirus vector further comprises a subgenomic promoter region (SG), for example the 26S promoter, or a functional equivalent thereof.

The term "sequences encoding human recombinant GDNF" refers to the nucleotide sequences encoding the neurotrophic factor derived from human glia, also known as ATF1; ATF2; HFB1-GDNF.

The access number for the genomic reference sequences of the GDNF gene sequence, derived from Homo Sapiens is NG_011675.1 RefSeqGene.

The access number for the mRNA and the GDNF gene sequence protein reference sequences derived from Homo Sapiens are:

 NM_000514.2 → NP_000505.1 glia-derived neurofrophic factor 1 isoform preprotein (SEQ ID NO. 3)

 NM_199231.1 → NP_954701.1 precursor to glia-derived neurotrophic factor 2 (SEQ ID NO. 4)

- NM_199234.1 → NP_954704.1 isoform 2 of the glia-derived neurotrophic factor (SEQ ID NO. 5).

The indicated access numbers can be found in the publicly available gene database of the National Center for Biotechnology Informatio n (NCBI) at http: / / w .ncbi.nlm.nih. gov. The nucleotide sequences encoding the human recombinant GDNF in the present invention can be located in various regions of the vector, as long as said sequence does not prevent replication or packaging of the vector. Preferably, the nucleotide sequences encoding the human recombinant GDNF in the present invention are located at the 3 'position of the non-structural coding sequences, more preferably at the 3' position of the subgenomic promoter (SG) and their expression is controlled by said promoter. SG.

The term "a functionally equivalent variant thereof" refers to a molecule, which is functionally similar to the complete GDNF protein or a fragment thereof. Protein variants can be practically prepared by chemical modification of the protein obtained according to the methods of the present invention, using methods known in the art. Naturally, said variant will have a receptor binding and intracellular signaling activity similar to the corresponding natural protein. Suitable methods for determining whether a variant of GDNF can be considered as a functionally equivalent variant includes, for example, the measure of the ability of said variant to promote the growth of neurites in PC12 cells in culture as described in Example 3.6 of the present invention or the measure of the ability to promote the reuptake of dopamine with high affinity for dopaminergic neurons of the midbrain as described by WO9306116 or the measure of the ability of the variant to promote the survival of cells of the sympathetic nervous system and parasympathetic as described in WO9306116.

Alternatively, protein variants can be obtained using the alphavirus expression vector where the sequence encoding hGDNF is conveniently modified at the level of its base sequence, and subsequently the corresponding protein variant is expressed. Variations in the primary structure of the protein, as well as variations in higher levels of structural organization, for example, in the type of covalent bonds that bind amino acid residues or the addition of groups to the terminal residues of the protein, are within the scope of the present invention. In addition, proteins may include conservative and non-conservative alterations in the amino acid sequence that result in silent changes that maintain the functionality of the molecule including, for example, deletions, additions and substitutions. Such altered molecules may be desirable when they provide certain advantages in their use. As used in the present invention, conservative substitutions would imply the substitution of one or more amino acids in the sequence of the corresponding protein with another amino acid having the same potency and ra ct er í sti ca s pa re ci da s of hydrophobicity / hydrophilicity giving rise to a functionally equivalent molecule. Such conservative substitutions include, but are not limited to, substitutions in the following amino acid groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine, histidine; phenylalanine, tyrosine; and methionine.

Variants of GDNF suitable for use in the present invention comprise those having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93% , at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with any of the GDNF sequences of human origin mentioned above throughout the entire sequence and, in particular, with isoform 1 of GDNF NP_000505.1), with isoform 2 (NP_954701.1 or NP_954704.1) of GDNF precursor to isoform 2 of neurotrophic factor derived from the glia. The degree of identity between two polypeptides is determined using computer algorithms and methods that are widely known to those skilled in the art. The identity between two amino acid sequences is preferably determined using the BLASTP algorithm [BLASTM Annual, Altschul, S. et al., NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990)].

Variants in the amino acid sequences of the protein defined above can be prepared by mutations in the nucleic acids encoding synthesized derivatives. Such variants include, for example, deletions, insertions or substitutions of residues in the amino acid sequence. Any combination of deletion, insertion and substitution can also be performed to achieve the final construction, as long as the final construction possesses the desired activity. Obviously, the mutations that will be made in the nucleic acid encoding the protein variant should not alter the reading phase and, preferably, will not create complementary regions that could produce a secondary mRNA structure.

At the genetic level, these variants are normally prepared by directed mutagenesis of nucleotides in the DNA encoding the protein molecule, thereby producing the DNA encoding the variant, and then expressing the DNA (or RNA) in the recombinant cell culture. Variants normally show the same qualitative biological activity as the non-variant protein.

An "analog" of the proteins defined above, according to the present invention, refers to an unnatural molecule, which is substantially similar to the whole molecules or to an active fragment thereof. Said analog would show the same activity as the corresponding natural protein. A "fragment" according to the present invention refers to any subset of molecules, that is, a shorter protein, which maintains the desired biological activity. The Fragments can be easily prepared by removing amino acids from any of the ends of the molecule and analyzing the result of their properties as receptor agonists. Proteases to simultaneously remove an amino acid from any of the N-terminal or C-terminal ends of a polypeptide are known in the art.

The alphavirus vectors of the present invention may lack at least one functional nucleic acid encoding a structural alphavirus protein selected from C, El, p62 and 6K. The gene sequences of the structural proteins can be made non-functional by, for example, a mutation or mutations, an insertion or insertions or a deletion or deletions, or a combination thereof. Preferably, the gene sequences of the structural proteins become non-functional by deletion, that is, the recombinant alphavirus vector is totally or partially absent. Thus, the most commonly used alphavirus vectors lack the nucleic acid encoding at least one, preferably all the alphavirus structural proteins selected from C, El, p62, and 6K. The alphavirus vectors should, however, comprise the 5 'and 3' regulatory sequences necessary for effective viral replication and packaging.

Alternatively, the alphavirus expression vector may comprise regions encoding some structural proteins of alphavirus, such as a sequence encoding a protein with translation enhancing activity.

In one embodiment, the sequence that codes for a protein with a translation-enhancing activity is the sequence that encodes the capsid of the Semliki Forest virus (SFV) comprising at least the first 34 amino acids thereof (Bl).

This sequence with a translation-enhancing activity it is a nucleic acid that can be linked to an activator, for example, a translation factor, to increase the level of translation. In the context of the present invention, any suitable gene translation enhancer can be used. By way of illustration, said enhancer may be the minimum SFV translation enhancer "Bl" comprising the nucleotide sequence encoding the first 34 amino acids of the SFV capsid. In one embodiment, the alphavirus expression vector further comprises a sequence encoding a self-cleavage protease or a target sequence for a cellular protease.

This sequence, when translated, provides a cleavage site whereby the expressed protein or the fused protein, as described below, is processed post-translationally or cotraductionally in the final protein.

In the context of the present invention, any nucleotide sequence encoding a post-translational auto-proteolytic cleavage site, and consequently the auto-p roteasao the amino acid sequence or peptide encoded by said nucleotide sequence. In one embodiment, the sequence encoding a self-cleavage protease or the target sequence for a cellular protease is FMDV 2A protease (FMDV), or FMDV 2A autoprotease. In another embodiment, said sequence comprises the nucleotide sequence encoding the carboxy-t-eminin 1 domain of the SFV capsid with protein 1 activity. The use of these post-translational auto-proteolytic disruption sites has been previously described in European Patent Application EP 736099 and also by Ryan and Drew (1994), particularly the use of the sequence encoding region 2A of the FMDV protein ( FMDV self-protection 2A), the complete content of which is included by reference. In one embodiment, the sequence encoding a self-cleavage protease or the target sequence for a cellular protease is expressed in phase with the sequence with translation enhancing activity (Bl).

In one embodiment, the alphavirus expression vector further comprises a sequence encoding a cis-cleaving auto-cleavage protease. Alternatively, the nucleotide sequence encodes a cleavage site for a trans-acting protease; in this case, said protease could be expressed by the cell transfected with the viral vector of the present invention, natively, or alternatively, said protease could be added exogenously to release the GDNF or a variant of the protein of fusion. In the context of the present invention, any nucleotide sequence encoding a cleavage site for a trans-acting protease can be used, and consequently the amino acid sequence encodes said sequence. By way of non-limiting illustration, said nucleotide sequence encoding a cleavage site of a trans-acting protease can be a nucleotide sequence encoding an amino acid sequence that can be cleaved by an endopeptidase, etc. By way of non-limiting illustration, said nucleotide sequence encoding a cleavage site for a trans-acting protease is a nucleotide sequence encoding a cleavage site for a virus protease, a potyvirus, for example, such as tobacco etching virus (ETV), etc., and said protease can be expressed by the cell transfected with the viral vector of the invention (natively or because it has been properly transformed), etc.

Alternatively, said cleavage site may be recognized by a chemical reagent, for example, cyanogen bromide, for cleavage in methionine residues, etc.

In one embodiment, the nucleotide sequence for the GDNF Human recombinant, or a functionally equivalent variant thereof, is fused in phase and downstream of the sequence encoding the self-cleavage protease or the target sequence for a cellular protease.

When the vector is used in the form of DNA, the complete vector comprises a functional promoter in eukaryotes, particularly a promoter that is recognizable by a eukaryotic RNA polymerase, such as a cytomegalovirus (CMV) promoter and a transcription termination signal sequence , a signal sequence derived from SV40, for example. In this way, the vector is transcribed to RNA inside the transfected cells where it will be self-amplified. Thus, in one embodiment, the alphavirus expression vector further comprises a promoter that is recognized by a eukaryotic RNA polymerase.

In one embodiment, the promoter recognizable by a eukaryotic RNA polymerase is the cytomegalovirus (CMV) promoter.

The total size or length of the recombinant alphavirus vector must be compatible for packaging into infectious alphavirus particles. More preferably, they should not exceed more than 20% of the size of a natural alphavirus genome.

The RNA or DNA constructs to prepare the viral vector of the invention can be obtained by conventional molecular biology methods included in the general laboratory manuals, for example, in "Molecular cloning: a laboratory manual" (Joseph Sambrook, David W. Russel Eds. 2001, 3rd ed. Cold Spring Harbor, New York) or in "Current protocols in molecular biology" (FM Ausubel, R. Brent, RE Kingston, DD Moore, JA Smith, JG Seidman and K. Struhl Eds, vol 2. Greene Publishing Associates and Wiley Interscience, New York, NY Updated September 2006. The alphavirus or alphavirus genomes or fragments thereof can be obtained by various techniques and from various sources. They can be artificially synthesized, cloned from plasmids or viruses isolated by RT-PCR, or derived or purified directly from virus samples deposited in libraries.

In a preferred embodiment, the alphaviral expression vector of the invention is a cytopathic vector. The term "cytopathic", as used in the present invention, refers to the fact that it is capable of inducing a series of morphological or functional changes in the cell as a result of viral infection and that they manifest as cell rounding, substrate separation, cell lysis, syncytium formation, formation of inclusion bodies or stopping the synthesis of endogenous proteins. The cytopathogenicity of a vector can be determined routinely by an expert using any method known in the state of the art including direct observation of the cells after contacting them with a vital dye, such as methyl violet, as described in patent application WO2008065225. Preferably, the cytopathic effect of the alphaviral expression vector results in cytopathic effect after a certain period of incubation of the cells with said vector in at least 80%, at least 85%, at least 90%, at least 95% of the cells.

Alternatively, the cytopathic effect is determined by measuring the inhibition in the cell's ability to synthesize endogenous proteins after infection with the virus or transfection with the viral vector. Preferably, the measure of the inhibition of the ability of the cell to synthesize endogenous proteins is carried out by a method as described in example 3 of the present invention wherein the inhibition in the synthesis of endogenous proteins is determined by measuring in the culture medium of a secreted protein so that a vector is considered to have a cytopathic effect when the levels of said secreted protein are 20%, 15%, 10%, 5%, 4%, 3%, 2% or 1% with respect to the levels produced by cells that have not been infected with the vector. In a preferred embodiment, said secreted protein is IGFBP-4, IGFBP-5 or IGFBP-7.

Eukaryotic cells

The present invention also relates to eukaryotic cells comprising an alphavirus vector according to any of the embodiments presented in the present invention.

Various eukaryotic cells can be efficiently transformed by the alphavirus expression vector, in particular of SFV.

The term "eukaryotic cells comprising an alphavirus expression vector" refers to, and without limitation:

 - eukaryotic host cells transcribed with the alphavirus expression vector in the form of DNA or RNA as defined in any of the embodiments presented in the present invention,

 eukaryotic host cells infected with viral particles generated from the alphavirus expression vector as defined in any of the embodiments presented in the present invention.

The cell population or cell line to be used in the present invention may comprise mammalian cells, such as red blood cells, epithelial cells, endothelial cells, fibroblasts, hepatocytes, neurons, glial cells, etc. The cells are preferably established as cell lines that can be cultured and stored. The cells can be of various mammalian origins, including human, rodent, bovine, pig, canine, etc. Preferred cells are of human or rodent origin (eg, murine, rat or hamster). Typical examples of such cells include BHK-21, CHO-K1, HEK293, VERO, and C6 glioma cells. It should be understood that any other mammalian cell can be used in the present invention.

Fusion proteins

 The present invention further relates to a fusion protein comprising the SFV capsid protein bound to the human GDNF protein, or a functionally equivalent variant thereof.

In one embodiment, the fusion protein comprises at least the first 34 amino acids of the SFV capsid protein bound to a self-cleavage protease, the latter also bound to the human GDNF protein, or a functionally equivalent variant of the same.

Such fusion proteins can be obtained from alphavirus constructs, in which:

- the nucleotide sequence that encodes the human recombinant GDNF, or a variant works 1 equivalent to it, is fused in 3 ^' position, and maintaining the reading phase, with the sequence encoding the self-cleavage protease or the target sequence for a cellular protease;

- the nucleotide sequence encoding the human recombinant GDNF, or a functionally equivalent variant thereof, is fused at 3 ^' position, and maintaining the reading phase, with the sequence encoding the self-cleavage protease or the sequence target for a cellular protease, the latter fused in 3 ^' position and in phase with the sequence coding for a protein with a translation enhancing activity;

- the nucleotide sequence that encodes the human recombinant GDNF, or a functionally equivalent variant thereof, is fused in 3 ^' position and maintaining the reading phase with the sequence that encodes for the self-cleavage protease or the target sequence for a cellular protease, the latter fused in phase and 3 ^' position with the sequence encoding the capsid of the Semliki Forest virus (SFV) comprising at least the first 34 amino acids Of the same.

In one embodiment the fusion protein is that of the sequence SEQ ID NO. 2. Methods for the production of hGDNF protein

 The present invention relates to a method for the production of a recombinant human GDNF protein, or a functionally equivalent variant thereof, comprising:

a) providing eukaryotic cells comprising an alphavirus expression vector, said vector comprising the nucleic acids of i) a 5 'sequence capable of directing the replication of the alphavirus; ii) a sequence coding for non-structural proteins capable of directing the replication of alphaviral RNA; iii) a subgenomic promoter of the alphavirus; iv) a sequence encoding the recombinant human GDNF, or a functionally equivalent variant thereof, operably linked to the subgenomic promoter that directs protein expression in eukaryotic cells; v) a 3 'sequence capable of directing the replication of the alphavirus;

b) culturing or incubating said eukaryotic cells in a culture medium until the synthesis of cellular endogenous proteins is inhibited;

c) remove the supernatant;

d) culturing or incubating said eukaryotic cells in a culture medium for a period of time, so that the expression of the recombinant GDNF is achieved, but without cell death; Y

e) purify the recombinant GDNF from the culture medium.

In one embodiment, the method for the production of human recombinant GDNF, or a functionally variant equivalent thereof, it further comprises f) purifying the recombinant GDNF by chromatography.

Step (a) of the method for the production of a recombinant human GDNF protein, or a functionally equivalent variant thereof, comprises providing eukaryotic cells comprising an alphavirus expression vector. The different components of the alphavirus expression vector have been defined in detail above and are used in the same manner in relation to the method for the production of a human recombinant protein.

Step (b) of the method for the production of a human recombinant GDNF protein, or of a variant f u n c i or n at 1 me n t and equivalent thereof is carried out for a time sufficient for the synthesis of cellular proteins to be inhibited.

The term "inhibition of cellular protein synthesis", as used in the present invention, refers to the fact that the cell loses the ability to synthesize proteins encoded by the genome itself at the expense of proteins encoded by the viral genome. The inhibition of cell protein synthesis can be determined by standard methods known to an expert, such as the determination of the levels or activity of endogenous proteins that naturally appear in the culture medium such as, for example. , IGFBP-4, IGFBP-5 and / or IGFBP-7 or by determining the ability of extracts obtained from infected cells to promote the translation of a particular mRNA or a fraction of poly (A +) compared to non-infected cell extracts, as described in van Stegg et al. (J.Virol., 1981, 38: 728-736). Step (b) of the method of the invention is maintained long enough for an inhibition of the synthesis of endogenous proteins of at least 50%, at least 60%, at least 70%, at least one 80%, at least 90%, at least 95% or 100% inhibition with regarding synthesis in the absence of viral infection.

In one embodiment, in the method for the production of human recombinant GDNF, or of a variant works 1 equivalent to it, the culture or incubation of steps b) or d) is carried out at a temperature between 30 and 40 ° C for a period of time between 2 and 50 hours. In an even more preferred embodiment, step b) is carried out at a temperature of 37 ° C, preferably for 4 or 8 h. Alternatively, step b) is carried out at a temperature of 33 ° C, preferably for 4, 8, 12 or 24 h. In an even more preferred embodiment, the culture or incubation of step b) is carried out at a temperature of 33 ° C for 8 hours. Step c) of the method of the invention comprises the removal of the culture supernatant resulting from step b).

Step d) of the method comprises culturing or incubating said eukaryotic cells in a culture medium for a period of time, so that the expression of the recombinant GDNF is achieved, but without cell death.

The term "cell death" is used interchangeably to refer to apoptosis or programmed cell death and refers to a process that involves a series of biochemical processes that give rise to a series of morphological modifications such as membrane modifications, nuclear fragmentation, Chromatin condensation, chromosomal DNA fragmentation and cell shrinkage. Suitable methods for determining the number of cells in the culture that suffer apoptosis include, among others, the dyeing with vital dyes, DNA fragmentation, caspases activity, decreased mitochondrial membrane potential, production of reactive oxygen species, condensation of chromatin and ex ter na 1 izacion of phostatidylserine. Preferably, step d) is carried out so that the number of dead cells in the culture is at most 1%, 2%, 3%, 4%, 5%, 6%, 7 %, 8%, 9%, 10%, 15%, 20% or 30% with respect to total cells in the culture.

In one embodiment, in the method for the production of human recombinant GDNF, or a functionally equivalent variant thereof, the culture or incubation of step d) is carried out at a temperature of 33 ° C or a temperature of 37 ° C . In another embodiment, the culture or incubation of step d) is carried out for 24 hours or 48 h. In an even more preferred embodiment, culture or incubation of step d) is carried out for 37 hours for 24 hours, for 33 hours for 33 hours, for 33 hours for 48 hours.

Step f) of the method for the production of GDNF comprises the purification of the recombinant GDNF from the culture medium

In one embodiment, in the method for the production of human recombinant GDNF, or of a variant f u n c i or n at 1 me n t and equivalent thereof, the alphavirus expression vector further comprises an in vitro transcribed RNA.

In one embodiment, in the method for the production of human recombinant GDNF, or of a variant f u n c i or n at 1 me n t and equivalent thereof, the alphavirus expression vector further comprises viral particles comprising the vector RNA.

In one embodiment, in the method for the production of human recombinant GDNF, or of a variant f u n c i or n at 1 me n t and equivalent thereof, the alphavirus expression vector further comprises a promoter that is recognizable by a eukaryotic RNA polymerase.

In one embodiment, in the method for the production of human recombinant GDNF, or a functionally equivalent variant thereof, the promoter recognizable by a eukaryotic RNA polymerase is the cytomegalovirus (CMV) promoter. In one embodiment, in the method for the production of human recombinant GDNF, or a variant works 1 equivalent to it, the alphavirus expression vector further comprises a sequence encoding a protein with a translation-enhancing activity.

In one embodiment, in the method for the production of human recombinant GDNF, or a functionally equivalent variant thereof, the sequence that encodes a protein with translation enhancing activity is the sequence that encodes at least the first 34 amino acids of the Semliki Forest virus (SFV) capsid. In one embodiment, in the method for the production of human recombinant GDNF, or a functionally equivalent variant thereof, the alphavirus expression vector further comprises a sequence encoding a self-cleavage protease or a target sequence for a cellular protease .

In one embodiment, in the method for the production of human recombinant GDNF, or a functionally equivalent variant thereof, the sequence encoding a self-cleavage protease or the target sequence for a cellular protease is expressed in phase with the sequence with translation enhancement activity.

In one embodiment, in the method for the production of human recombinant GDNF, or of a variant works 1 equivalent to it, the sequence encoding a self-cleavage protease is the 2A self-protection of foot-and-mouth disease virus (FMDV) .

In one embodiment, in the method for the production of human recombinant GDNF, or a functionally equivalent variant thereof, the nucleotide sequence encoding the human recombinant GDNF, or a functionally variant equivalent thereof, it is fused in 3 ^' position and maintaining the reading phase with the sequence coding for the self-cleavage protease or the target sequence for a cellular protease.

In one embodiment, in the method for the production of human recombinant GDNF, or a functionally equivalent variant thereof, the alphavirus is SFV. In one embodiment, in the method for the production of human recombinant GDNF, or of a variant f u n c i or n at 1 me n t and equivalent thereof, eukaryotic cells are mammalian cells selected from BHK, CHO, VERO, and C6 glioma cells.

In one embodiment, eukaryotic cells comprising an alphavirus expression vector according to the present invention can be prepared by first obtaining a template DNA for RNA synthesis. This method for the preparation of a template DNA comprises linearizing the plasmid pSFV-hGDNF by incubating said plasmid with a suitable restriction enzyme, such as Spe I. Once the plasmid has been cleaved correctly, the digestion product of the Plasmid is conveniently extracted by mixing with, for example, phenol / chloroform in the presence of a salt such as, for example, NaAc, stirring, centrifugation and transfer of the upper phase to a new tube. This extraction can be repeated as desired. The plasmid is then precipitated by the addition of cold absolute ethanol, followed by stirring, incubation at -20 °, centrifugation, removal of the supernatant, and addition of 70% ethanol. A subsequent centrifugation, discarding the supernatant, allows to obtain a precipitate containing the linearized plasmid.

In one embodiment, eukaryotic cells containing an alphavirus expression vector, according to the present invention, they can be prepared by first obtaining a template DNA for the synthesis of AR. RNA synthesis can be performed by preparing a mixture of linearized plasmid pSFV-hGDNF prepared as described in the previous paragraph. The mixture preferably comprises the linearized plasmid pSFV-hGDNF, reaction buffer, CAP analog (m7G (5 ^' ) ppp (5 ^' ) G) (New England Biolabs. Ref. S1404S), nucleotide triphosphate (ATP, CTP, UTP, and GTP), DTT, RNase inhibitor (Promega. Ref. N2511), SP6 polymerase (New England Biolabs. Ref. M0207S). The mixture is incubated under suitable conditions to increase RNA synthesis, preferably for 1 hour at 37 ° C.

In one embodiment, eukaryotic cells comprising an alphavirus expression vector according to the present invention can be prepared by electroporation of BHK cells with SFV-hGDNF RNA as obtained in the preceding paragraph and the expression of hGDNF. This protocol includes the growth of BHK cells in culture bottles until they reach confluence (a 75 cm ² confluent culture bottle comprises approximately 5 x 10 ⁶ cells). The cells are trypsinized, counted and centrifuged. Optionally, they are subsequently washed with, for example, phosphate buffered saline (PBS without Ca / Mg), centrifuged and resuspended again in PBS without Ca / Mg. Then, said cells are mixed with the RNA reaction described above, and transferred to an electroporation cuvette. The electroporation is carried out later. Preferably, electroporation is performed at room temperature by applying two consecutive 800 volt pulses, maintaining the capacitance at 25 F (Biorad electroporator). These conditions are most suitable in the case of BHK cells, since they give rise to almost 100% electroporated cells, thereby blocking almost 100% of protein synthesis in host cells in the culture. If several aliquots of cells are electroporated, they can be mixed and diluted in complete BHK medium (Glasgow-MEM (Invitrogene. Ref. Gibco 21710), supplemented with fetal bovine serum (FBS) at room temperature and subsequently plate the total volume in culture jars. It is not necessary to mix the cells of two electroporations, but doing so conveniently reduces the volume of the medium from which the hGDNF will be purified. Next, electroporated cells are preferably incubated for 6 to 12 hours, more preferably for about 8 hours at 33 ° C with 5% C0 ₂ . This incubation time period allows a convenient inhibition of cell protein synthesis. Subsequently, the supernatant is removed, thus eliminating the culture medium comprising serum and the cellular proteins already produced, and the cells are subsequently washed with PBS (without Ca / Mg). BHK medium without serum is added and the mixture is incubated, preferably at 33 ° C with 5% C0 ₂ for 48 h, more preferably for 24 h. It is preferable not to incubate the mixture for too long, thus preventing cell lysis and thus releasing small amounts of protein to the supernatant that could interfere with the purification of hGDNF. The culture medium is then collected, centrifuged and the supernatant filtered and purified to discard any material except hGDNF protein.

Obviously, other suitable culture media can be used, depending on the type of eukaryotic cells used. In the previous embodiment, the BHK culture medium (G-MEM, Gibco) was used, since BHK cells were used.

Alternatively, in another embodiment, eukaryotic cells comprising an alphavirus expression vector according to the present invention can be prepared by infection of BHK cells with SFV-hGDNF viral particles and hGDNF expression. The production of SFV viral particles is based on the coelectroporation of BHK cells with the recombinant RNA of SFV-hGDNF and with two helper RNAs (or helper), which carry genes that encode the capsid of SFV, and envelope proteins. , respectively, (Smerdou and Liljestróm, 1999). According to this methodology, template DNAs and RNAs are prepared from plasmids pSFV-hGDNF, pSFV-helper-S2, and pSFV- helper-C-S219A as described above. BHK cells are prepared as described and the resuspended cells are mixed in PBS with SFV-hGDNF RNA, SFV-helper-S2, and SFV-helper-C-S219A. Then, the mixture is transferred to an electroporation cuvette. Preferably, electroporation is performed at room temperature by applying two consecutive 800 volt pulses, maintaining the capacitance at 25] iF (Biorad electroporator). The electroporated cells are then diluted in complete BHK medium supplemented with FBS at room temperature and preferably incubated for 24-48 hours at 33 ° C with 5% C0 ₂ . The medium is collected, centrifuged to remove cell debris, and the supernatant comprising the viral particles can be frozen and stored at -80 ° C.

In one embodiment, the infection of cells with viral particles prepared above can be performed according to the following methodology. BHK cells are grown in culture bottles until they reach confluence. The cells are then washed with PBS (with Ca / Mg) and subsequently infected with viral particles of SFV-hGDNF at a multiplicity of infection (moi) of ≥5 (at least 2.5 x 10 ⁷ viral particles for 5 x 10 ⁶ cells) by adding the required amount of virus diluted in infection medium (for example, MEM containing 0.2% BSA, 2 mM glutamine and 20 mM Hepes). The adsorption of the virus is allowed to proceed, preferably for 1 h at 37 ° C. BHK medium with FBS is added to the infected cells and the mixture is incubated, preferably between 6 and 12 hours, more preferably for 8 hours, at 33 ° C with 5% C0 ₂ . This incubation time period allows a convenient inhibition of cell protein synthesis. Subsequently, the supernatant or culture medium is removed, and the cells are washed as many times as desired with PBS (without Ca / Mg). This washing step allows the removal of serum and cellular proteins present in the medium. Then, BHK medium without FBS is added and the mixture is incubated, preferably at 33 ° C with 5% C0 ₂ for 48 h, more preferably for 24h. It is preferable not to incubate the mixture for too long, thus preventing cell lysis and thus releasing small amounts of protein to the supernatant that could interfere with the purification of hGDNF. The culture medium is collected, centrifuged and the supernatant filtered and purified to discard any material except the hGDNF protein.

Alternatively, in another embodiment, eukaryotic cells comprising an alphavirus expression vector according to the present invention can be prepared by transfecting BHK cells with (CMV) -SFV-hGDNF DNA with lipofectamine or other transfection reagent. According to this methodology, BHK cells are grown to reach 40-70% confluence. SFV-hGDNF DNA and lipids are diluted separately in serum-free Optimem (Gibco) media. Although the ratio of DNA / lipofectamine can be optimized for each new DNA preparation, 1 g of SFV DNA / 5 μΐ of lipofectamine (Gibco, ref. 18324-012) is a preferred combination for 10 ⁶ cells. Then the dilution of the lipids and the dilution of the DNA are mixed and stirred. The mixture is incubated at room temperature and the culture medium is extracted from the cells, followed by the addition of Optimem medium free of fetal bovine serum to the cells. After incubation, preferably at 37 ° C, the medium is re-extracted from the cells, and FBS-free Optimem medium is added to the mixture of lipids and DNA. The mixture is added to the cells and preferably incubated at 37 ° C for 1 hour. The lipid-DNA mixture is removed from the cells, the BHK medium is added with FBS, and incubated for 6 to 12 hours, more preferably for about 8 hours at 33 ° C with 5% C0 ₂ . This incubation time period allows a convenient inhibition of cell protein synthesis. Subsequently, the supernatant is removed, thereby eliminating the culture medium containing FBS and the endogenous cellular proteins already produced, and the cells are washed with PBS (without Ca / Mg). BHK medium without FBS is added and the mixture is incubated, preferably at 33 ° C with 5% C0 ₂ for 48 h, more preferably for 24h. It is preferable not to incubate the mixture for too long, thus preventing cell lysis and thus releasing small amounts of protein to the supernatant that could interfere with the purification of hGDNF. The culture medium is then collected, centrifuged, the supernatant filtered and purified to discard any material except hGDNF protein.

Other methods of transfection such as those using calcium phosphate, the use of liposomes, electroporation and the like can also be used.

In one embodiment, step b) is carried out at approximately 37 ° for approximately 8 h and step d) is carried out at approximately 37 ° for approximately 24 h. In another embodiment, step b) is carried out at approximately 37 ° for approximately 8 h and step d) is carried out at approximately 33 ° for approximately 24 h. In another embodiment, step b) is carried out at approximately 33 ° for approximately 8 h and step d) is carried out at approximately 33 ° for approximately 24 h. In another embodiment, step b) is carried out at about 33 ° for about 12 h and step d) is carried out at about 33 ° for about 24 h.

In one embodiment, the hGDNF obtained is subsequently purified according to the following methodology. A column of SP-sepharose is connected to a peristaltic pump. The column is preferably equilibrated with 10 column volumes (CV) of phosphate buffer at a constant flow rate of 1.5 ml / min. The pH of the culture medium containing hGDNF is adjusted to 8.2 with NaOH and the medium is filtered through a 0.22 μιτι filtration unit. The sample to be purified is loaded into the column and the flow (FT) is collected. The column is then washed, preferably with 10 CV of phosphate buffer, pH 8.2, and the wash is collected. The bound hGDNF is eluted, preferably with phosphate buffer, pH 7.4, and high concentrations of NaCl.

In a preferred embodiment, eukaryotic cells are transformed by electroporation. The electroporation technique is well known in the field of biotechnology and an expert in the field can establish the optimal conditions. Briefly, approximately 25 g of RNA synthesized in vitro are mixed with 5 x 10 ⁶ BHK-21 cells and electroporated in a 0.4 cm cuvette by applying two consecutive 800 V pulses and maintaining the capacitance at 25] iF.

In another embodiment, eukaryotic cells are infected by viral particles produced by co-electroporation with the recombinant SFV-GDNF RNA and two helper RNAs that carry the genes encoding the SFV capsid and envelope proteins (SFV-helper -S 2 and SFV-helper-C-S219A, respectively) (Smerdou and Liljestróm, 1999).

Briefly, approximately 50 g of SFV-hGDNF RNA, 50] ig of SFV-helper-S2, and 50] ig of SFV-helper-C-S219A are mixed with 5 x 10 ⁶ BHK-21 cells, resuspended in 0.8 mi of PBS and electroporated in a 0.4 cm cuvette by applying two consecutive 800 V pulses and maintaining the capacitance at 25 iF.

In another embodiment, 5xl0 ⁶ BHK-21 cells are washed with 12 ml of PBS (with Ca / Mg) and infected with SFV-hGDNF viral particles at a moi of ≥5 (at least 2.5x10 ⁷ viral particles for 5 x 10 ⁶ cells) by adding the required amount of virus diluted in 3 ml of infection medium (MEM containing 0.2% BSA, 2mM glutamine and 20 raM Hepes).

In another embodiment, ⁵ x 10 ⁶ BHK-21 cells are transformed by incubation at room temperature for 15 minutes with 5 g of SFV DNA / 25 μΐ of lipofectamine (Gibco, ref. 18324-012). In the present invention, any culture medium suitable for mammalian cells, including RPMI, DMEM, supplemented with conventional additives (antibiotics, amino acids, serum, etc.) can be used. Cells can be grown and stored in any appropriate device (tubes, flasks, bottles, etc.). Cell viability or absence of contamination can be verified before carrying out the methods of the present invention. Kit for the production of human recombinant GDNF

In one embodiment, the present invention provides a kit for use in a method of producing recombinant human GDNF, comprising any of:

 - an alphavirus vector according to any of the previous embodiments;

 - eukaryotic cells comprising the alphavirus vector according to any of the above embodiments;

 - culture medium; or

 - a combination thereof.

The present invention further relates to the use of an alphavirus or alpha viral particle expression vector according to any of the embodiments presented in the present invention for the production of recombinant human GDNF protein, or functionally equivalent variants thereof.

The present invention relates to the use of eukaryotic cells comprising the alphavirus expression vector according to any of the embodiments presented in the present invention for the production of recombinant human GDNF protein, or functionally equivalent variants thereof. Compositions comprising glycosylated GDNF and therapeutic uses thereof The authors of the present invention have developed a method of purification of recombinant glycosylated GDNF that allows to obtain compositions comprising GDNF in amounts greater than those described in the state of the art. Therefore, in another aspect, the invention relates to a composition comprising human GDNF or a functionally equivalent variant of GDNF wherein the GDNF is glycosylated and wherein the composition

 (i) comprises a percentage of GDNF by weight with respect to the total protein in the composition greater than 90% and / or

 (ii) is substantially free of IGFBP-4,

 IGFBP-5 and / or IGFBP-7. The terms "GDNF" and "functionally equivalent variant" have been described in detail previously.

The term "percentage" refers to the percentage of GDNF with respect to the total protein in the sample. Thus, 90% of GDNF implies that of every 100 protein in the composition, at least 90 g correspond to GDNF. The percentage of glycosylated GDNF in the sample is at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or at least 100%.

In a preferred embodiment, the GDNF is of human origin. The term "functionally equivalent variant" has been described in detail above. In a preferred form, the functionally equivalent variant shows an identity of at least 94% with respect to GDNF of human origin.

The term "glycosylated," as used in the present invention refers to a molecule in which at least one of the N-glycosylation sites, preferably the glycosylation sites at positions 126 and 162 in the human pre-proGDNF sequence. and the corresponding ones in the functionally equivalent variants of GDNF, are glycosylated. Typically, the structure of glycosylation moieties is that which appears in mammalian cells and comprising glycans of the complex or hybrid type modified in terminal position by sialic acid residues, preferably disialiated and trisyallylated. Preferably, the glycosylated GDNF according to the invention contains at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least one 96%, at least 97%, at least 98%, at least 99% or 100% of the remnants of complex-type or sialylated hybrid glycans.

The expression "substantially free of IGFBP-4, IGFBP-5 and / or IGFBP-7" refers to the compositions containing at most 5%, 4%, 3%, 2%, 1%, a 0.5%, 0.1%, 0.05%, 0.01% of one or more proteins selected from IGFBP-4, IGFBP-5 and / or IGFBP-7. In a preferred embodiment, the compositions of the invention are substantially free of IGFBP-5 and / or IGFBP-7.

The term "IGFBP-4", as used in the present invention refers to a protein that is capable of binding IGF-I and IGF-II as described by LaTour et al. (Mol. Endocrinol., 1991, 4: 1806-14)

The term "IGFBP-5", as used in the present invention refers to a protein with IGF-I and / or IGF-II binding capacity, the molecular weight of which is approximately 30 kDa, its pl of approximately 8, 6 and which was described by Allander et al. (J. Biol. Chem. 269: 10891-8).

The term "IGFBP-7" as used in the present invention refers to a protein with IGF-I binding capacity whose pl is 8.3 as described by Wilson et al. (J. Clin. Endocrinol. Metab. 86: 4504-11).

Preferably, the compositions of the invention show a specific activity superior to the compositions described in the state of the art. The term "specific activity", as used in the present invention, refers to the activity of an enzyme per milligram (mg) of protein and is usually expressed in units of activity per milligram of protein. In a preferred embodiment, the compositions of the invention show a specific activity greater than 1 x 10 ⁷ units / mg determined by the ability to promote survival and stimulate the growth of neurites from neurons obtained from the dorsal root ganglion (Davies, AM (1989) in Neurotrophic Factor Bioassay Using Dissociated Neurons, Nerve Gro th Factor. Rush, RA (eds): John Willey and Sons, Ltd. 95).

In a preferred embodiment, the compositions of the invention show a specific activity greater than 25,000 TU / mg determined by the ability to promote dopamine uptake in midbrain cultures according to the method of measuring the ability of GDNF to promote Tritiated dopamine uptake in cells of primary rat embryonic mesencephalon cultures under the conditions described by Lin et al. (J. Eurochem., 1994, 63: 758-768). In particular, the determination according to Lin et al. understands:

 - Contact cells in culture of 6 or 7 days with

[ ³ H] DA at 50 nM in uptake buffer (Krebs-Ringer 's phosphate buffer pH 7.4 and 5.6 mM glucose, 1.3 mM EDTA, 0.1 mM ascorbic acid and 0.5 mM pargiline for 15 minutes at 37 ° C.

 - Wash the cells with the capture buffer,

Release [ ³ H] DA from the cells by incubating them with 0.5 ml of 95% ethanol for 30 min at 37 ° C,

 Determine the radioactivity in 10 ml of EcoLite (ICN). Background values were obtained by adding to the 0.5 mM GBR-12909 uptake buffer.

The number of trophic units (TU) of GDNF activity is determined as the reciprocal of the dilution that resulted in 50% of the maximum stimulation of uptake of [ ³ H] DA by the culture. The specific activity is the ratio between the value of TU per milliliter and the concentration of protein per milliliter. In another aspect, the invention relates to a composition according to the invention for use in medicine.

In another aspect, the invention relates to a composition according to the invention for use in the treatment or prevention of a neurodegenerative disorder.

In another aspect, the invention relates to the use of a composition according to the invention for the preparation of a medication for the treatment or prevention of a neurodegenerative disorder.

In another aspect, the invention relates to a method for the treatment or prevention of a neurodegenerative disorder in a subject comprising the administration to said subject of a composition according to the invention.

The term "neurodegenerative disorder" as used in the present invention refers to any type of alteration in which neuronal integrity is altered and includes, without limitation, motor neuron disorders including amyotrophic lateral sclerosis, neurological disorders associated with diabetes, Parkinson's disease, Alzheimer's disease, and Huntington's chorea, glaucoma or other diseases and conditions that involve degeneration of retinal ganglion cells; sensory neuropathy caused by injury, or insults, or degeneration, of sensory neurons; pathological conditions, such as inherited retinal degenerations and age-related retinopathies, diseases or injuries, in which photoreceptor degeneration occurs and is responsible for vision loss; and lesion or degeneration of sensory cells of the inner ear, such as hair cells and auditory neurons to prevent and / or treat hearing loss due to a variety of causes.

Brief description of the figures

 Figure 1. Purification of rat GDNF from the conditioned medium of BHK cells. Analysis of the fractions obtained after cation exchange chromatography of conditioned media of transfected BHK cells with rat GDNF. Fractions eluted with a NaCl gradient were analyzed by SDS-PAGE, followed by staining with Coomasie Blue. Fractions containing rat GDNF (14-16) also have a very abundant protein that was identified as IGFBP-5.

Figure 2. Purification of human GDNF from medium conditioned of MDX-12 cells transduced with a lentiviral vector containing hGDNF: cation exchange chromatography. The conditioned medium obtained from MDX-12 was adjusted to pH 8.2 and then passed through a fast-flowing resin of SP-Sepharose. The bound hGDNF was eluted with a gradient of 0.15 to 1 M NaCl. 2 ml fractions were analyzed by SDS-PAGE under reducing conditions followed by staining with Coomassie blue (A) or Western blotting to detect hGDNF (B) or IGFBP-7 (C).

Figure 3. Purification of human GDNF from conditioned medium of MDX-12 cells transduced with a lentiviral vector containing hGDNF: gel filtration chromatography. SP-Sepharose chromatography fractions containing hGDNF and low amounts of IGFBP-7 were desalted and concentrated by lyophilization. The lyophilisate was resuspended and applied to a Superdex 200 HR column. (A) Protein chromatogram (absorbance at 215 nm) versus volume (mi). The horizontal bar indicates the fractions that were analyzed by SDS-PAGE followed by staining with Coomasie blue (B). The first peak of the chromatogram corresponds to the IGFBP-7 and the second to the GDNF.

Figure 4. SFV-hGDNF expression vector. (A) Vector diagram. The vector contains the SFV replicase followed by a subgenomic promoter (Pr sg). The ORF encoding hGDNF is located downstream of the Pr sg fused in phase with the minimum translation enhancer of the SFV capsid (Enh bl) and FMDV 2A autoprotease (2A). Enh bl codes for the first 34 amino acids of the SFV capsid and 2A codes for the 17 amino acids indicated in the figure. (B) Expression of hGDNF. BHK cells were electroporated in duplicate with hGDNF RNA and 24 h later the presence of hGDNF in the supernatants was analyzed by Western blotting (channels 1 and 2). RNA electroporated cells of an SFV vector encoding puromycin N-acetyl transferase were used as a negative control (SFV-pac). The supernatant of MDX-12 cells expressing hGDNF (GDNF lenti) or commercial rat GDNF expressed from a baculovirus vector in cells Insects (insect GDNF) were used as positive controls. The amount of purified recombinant protein or supernatant (insect GDNF) used in this study is indicated under the gel.

Figure 5. Analysis of the conditioned medium of BHK cells electroporated with the SFV vector. It was analyzed by Western blotting of the conditioned medium of electroporated BHK cells with SFV-hGDNF RNA or without RNA (control). Once the cells were electroporated, the medium was changed to medium without serum at the indicated times and was collected 24 h later. hGDNF is expressed at elevated levels in the middle of transfected cells. Two proteins secreted to the culture medium in transfused cells without RNA, IGFBP-5 and IGFBP-4, have completely disappeared due to the strong inhibition of endogenous protein synthesis induced by the SFV vector. The stern transfer of β-actin was performed from cell lysates that indicated that all culture wells contained the same initial amount of cells.

Figure 6. Purification of human GDNF from BHK cells t r a n s f e c t ada s with an SFV vector containing hGDNF: cation exchange chromatography. The conditioned medium obtained from the BHK cells was adjusted to pH 8.2 and then passed through a fast-flowing resin of SP-Sepharose. The bound hGDNF was eluted in a single step with 0.5 M NaCl (El) and the eluate was analyzed by staining with Coomasie Blue (A) and Western blotting (B). L: Conditioned medium loaded in the column: FT: Conditioned medium after passing through the column; W: column wash; El: elution with 0.5 M NaCl; E2: elution with 1 M NaCl.

Figure 7. GDNF induced differentiation of PC-12. PC-12 cells were incubated at a low density (2 x 10 ³ cells / cm ² ) in collagen coated culture plates. To the culture medium was added pure glycosylated hGDNF (25 ng / ml) purified from the supernatant of BHK cells transfected with the SFV-hGDNF vector, or non-glycosylated hGDNF produced in bacteria (50 ng / ml) on day 0. Phase contrast images were taken on day 8. Figure 8. Comparison between two protocols for the purification of human glycosylated GDNF. In the left panel, a modification of the protocol described by Ansorena et al. (2009) for the purification of glycosylated human GDNF. In the central and right panels, the method of the invention to easily produce a high amount of glycosylated GDNF from transfected BHK cells with an SFV vector expressing hGDNF applied at two different preparative scales.

 Figure 9. Study of the stability of glycosylated GDNF after purification of transfected BHK cells with SFV-hGDNF. The figure shows that most of the non-glycosylated protein degrades after 24 hours of incubation at room temperature and disappears after 48 hours. However, glycosylated hGDNF is still present after 3 weeks of incubation at room temperature.

Examples

 Example 1: Production of human glycosylated GDNF using stably transfected BHK cells with hGDNF

BHK cells are commonly used for transfection. This cell line has already been used to stably express and purify the rat GDNF (rGDNF) from the conditioned medium. To do this, a cDNA fragment containing the coding region of the rGDNF gene was obtained by PCR of the total rat brain RNA Pl and was cloned into the vector pDEST26 using Invitrogen Gateway technology. BHK cells were transfected with pDEST26-GDNF and cell clones stably expressing rGDNF selected with G-418 (Invitrogen). The rGDNF released to the culture medium was purified through two steps comprising a cation exchange chromatography followed by a molecular exclusion chromatography (Garbayo et al., 2007). A recurring problem that was observed when attempting to purify the rat GDNF from the medium of BHK cells expressing this protein was the copurification of another protein present in the supernatant, which was identified by LC-ESI-MS / MS analysis as IGFBP-5 (16 peptides corresponding to IGFBP-5 were detected with a 52% coverage of the peptide chain). After SP-Sepharose chromatography, analysis of the fractions by SDS-PAGE followed by staining with Coomasie Blue revealed the presence of two main bands, the upper one corresponding to the IGFBP-5 and the lower one to rGDNF. The fractions containing the peaks of the two proteins overlapped so that the fractions containing the majority of rGDNF also had IGFBP-5. This protein has a molecular weight (MW) of 30 kDa and a pl of 8.6, being present when the rGDNF dimer was purified from this cell line (Figure 1) (Garbayo et al. 2007).

 Using the same procedure, a stable BHK cell line was generated that expressed human GDNF, but in this case, the cells were not able to produce adequate amounts of hGDNF to allow the purification process. On the other hand, due to the fact that BHK cells produce IGFBP-5 at elevated levels and this protein is copurified with GDNF, it was decided to produce hGDNF from a different cell line. Example 2: Production of human glycosylated GDNF using immortalized and transduced human dermal fibroblasts with a lentiviral vector containing hGDNF

 In a different strategy, hGDNF was expressed using a cell line of human dermal fibroblasts immortalized and transduced with a lentiviral vector (pCCL-WPS-hGDNF) containing the hGDNF gene (MDX-12 cells) (Sajadi et al., 2006 ). These cells were grown in DMEM with Glutamax supplemented with 10% FBS, 100 units / ml of penicillin and 100 g / ml of streptomycin. The hGDNF was purified from the conditioned medium (supernatant) of the MDX-12 cells to obtain a very low amount of biologically active hGDNF.

2.1. Collection of conditioned medium

MDX-12 cells were grown in a medium with 10% FBS until reaching 80% confluence. After washing with PBS, the cells were grown in 175 cm ² culture bottles with 22 ml of serum-free medium. The conditioned medium containing hGDNF is collected every 48 h and stored at -20 ° C

2.2. Purification of hGDNF from the conditioned medium

 A total amount of 20 L of conditioned medium was used for the purification of hGDNF. The medium was thawed, the pH was adjusted to 8.2 with NaOH and the medium was filtered through a 0.22 μιτι filtration unit. The hGDNF was purified in three chromatography steps as described below. Chromatography 1: Cation Exchange Chromatography

A total amount of 20 L of conditioned medium from MDX-12 cells was processed in two batches of 10 L each. The SP-Sepharose resin (GE Healthcare Biosciencies) (30 ml) was packed in a XK / 16/20 column (GE Healthcare Biosciencies) and 10 L of the conditioned medium containing hGDNF was passed at a flow rate of 3 ml / min for 2.5 days at 4 ° C. The column was washed with 10 column volumes (CV) of 10 mM phosphate buffer pH 8.2, 150 mM NaCl and 5 mM EDTA at the same flow rate. The bound hGDNF was eluted with a linear gradient of 0.15 M to 1 M NaCl in the same buffer, at a flow rate of 0.62 ml / min. 2 ml fractions were collected and analyzed by SDS-PAGE followed by staining with Coomasie Blue and Western blotting under reducing conditions (Figure 2). Staining with Coomasie Blue showed two major bands present in most fractions (Figure 2A). A band corresponding to a protein with a MW of 29 kDa eluting at lower concentrations of salt was the most abundant. The second band of 18 kDa began to elute at 0.5 M NaCl and its MW agreed with the expected size for the hGDNF monomer. Western blot analysis with an hGDNF specific antibody confirmed that the lower MW band corresponded to this neurotrophic factor (Figure 2B). In order to separate both bands in the next stage, the 29 kDa protein was identified by mass spectrometry. The gel fragment that contains the Band was cut and sent for identification. Analysis by LC-ESI-MS / MS revealed that the contaminating protein was the human insulin-like growth factor binding protein 7 (IGFBP-7) with 20 peptides that match this protein, corresponding to 32% of the sequence . This result was confirmed by Western blotting with an antibody specific for IGFBP-7 (Figure 2C).

issue

The first chromatography did not allow us to obtain pure hGDNF due to the copying of IGFBP-7. If the physicochemical properties of IGFBP-7 and hGDNF are compared, both proteins are very similar since they have a high theoretical plot of 8.3 and 9.26, respectively, so they both bind to the cation exchanger . Although IGFBP-7 has a lower pl and, therefore, elutes at a lower salt concentration than hGDNF (Figure 2A), the abundance of IGFBP-7 widens its peak overlapping with the peak corresponding to the elution of hGDNF. HGDNF is a homodimeric protein with a MW very similar to that of IGFBP-7. Due to the abundance of both proteins in the same fractions, it is not possible to separate them by gel filtration chromatography. In order to be able to continue with the purification of hGDNF, only fractions (29 to 40) with a low amount of IGFBP-7 can be used to continue the purification process, having to discard the fractions containing the majority of hGDNF recombinant

Chromatography 2: cation exchange chromatography

Since the main physicochemical difference between both proteins is the pl, the fractions containing hGDNF and a low amount of IGFBP-7 were repeated cation exchange chromatography. Only fractions (29-40) eluted from the first cation exchange chromatography (24 ml), containing approximately 0.7 M NaCl, were used. The whole fractions were diluted 4.6 times in 10 mM phosphate buffer. , pH 8.2, 5 mM EDTA to achieve a NaCl concentration of 0.15 mM and were reloaded onto the same cation exchange column. Chromatography was performed under the same conditions as chromatography 1 and the results were very similar. At this stage, it was possible to slightly separate the peaks of both proteins. In this way, the purification process continued with the same group of fractions (29-40) enriched in hGDNF, but still contained less IGFBP-7.

Chromatography 3: Gel filtration

To continue the purification of hGDNF, the group of fractions selected from the second chromatography (24 ml) were desalted to 50 raM NaCl in 10 raM phosphate buffer pH 8.2 using a HiPrep 26/10 desalination column (GE Healthcare Biosciences) in an FPLC AKTA purifier (GE Healthcare B ios ci e nc ies) at a flow rate of 3 ml / min. Protein concentration was monitored throughout the process and all fractions containing protein were collected and pooled. At this stage, the initial volume was diluted 1.5 times. Since the maximum loading volume in this column is 15 ml, this chromatography was performed in two stages (2 x 12 ml).

 The sample was concentrated by lyophilization and resuspended in the smallest possible volume (3 ml). Finally, the fractions containing proteins were loaded into a Superdex 200 HR 10/30 (GE Healthcare Biosciencies) using the FPLC AKTA purifier at a flow rate of 0.5 ml / min. 0.5 ml fractions were collected and analyzed by SDS-PAGE followed by staining with Coomasie Blue. The chromatogram showed a very narrow peak that eluted at 16 ml and that corresponded to IGFBP-7 and a wider peak that contained the different forms of glycosylated hGDNF eluted at 19 ml (Figure 3A). When the hGDNF fractions were analyzed by Coomasie Blue staining (Figure 3B), some of them still contained the contaminating protein and were discarded for further studies. Fractions containing pure hGDNF were lyophilized and stored at -80 ° C.

Conclusion : Using this protocol it has been possible to purify 107 ± 22] ig of glycosylated hGDNF, which is approximately 1% of the GDNF contained in the initial sample. However, the procedure to obtain this small amount of protein is very laborious and time-consuming, since it starts from a large amount of conditioned medium (20 L), obtained in turn from a large number of cells. The total time of the hGDNF purification process from the conditioned medium is 16 days. This includes the steps described above, which are summarized in Figure 8 (left panel), together with the protein analysis (SDS-PAGE, Coomassie Blue staining and Western blot) performed after each purification to determine the fractions containing hGDNF with a minor contamination of IGFBP-7. However, the main problem is the high level of co-purification of IGFBP-7 that forces the majority of hGDNF-containing fractions to be discarded to obtain a pure protein.

Example 3: Production and purification of human glycosylated GDNF from mammalian cells transfected or infected with a Semliki Forest virus vector expressing hGDNF (SFV-hGDNF)

 3.1. Construction of the SFV-hGDNF vector

The complete cDNA corresponding to hGDNF was amplified by PCR from a human astrocyte cell line, SVGpl2 (Moretto et al., 1996) and was cloned into plasmid pDONR201 (Invitrogen) following the manufacturer's instructions. The primers used were: 5 ^' - GGGGACAAGTTTGTACAAAAAAGCAGGCTTCTTAAGATGAAGTTATGGGATGTCG-3 ^' (SEQ IDNO: 6), and 5

GGGGACCACTTTGTACAAGAAAGCTGGGTTCAGATACATCCACACCTTTTAGCG-3 ^' (SEQ ID NO: 7), where the underlined sequences hybridize with the 5 ^' and 3 ^' ends of the hGDNF gene, respectively. For the preparation of the SFV-hGDNF expression vector, the hGDNF gene was amplified by PCR of the plasmid p DONR201-GDNF using the loss of guidelines: 5 ^' - CGTAGTACGTAcccgggAAGTTATGGGATGTCGTGGC-3 ^' (SEQ ID NO: 8) where the hybrid underlined sequence with the 5 ^' end of the hGDNF gene and 5 ^" -CGTAGTACGTAcccgggrCAGATACATCCACACCTTTTAGC-3 ^' (SEQ ID NO: 9) where the underlined sequence is complementary to the 3' end of the hGDNF gene (italic stop codon). A 0.67 kb fragment was obtained that was digested with Xma I (sites indicated in bold) and was cloned into the unique Xma I site of pSFV-bl2A (Rodriguez-Mado z et al., 2005), generating plasmid pSFV-hGDNF. The hGDNF gene was cloned in phase with the sequence which codes for the first 34 amino acids of the SFV capsid (Bl) and FMDV 2A autoprotease The first hGDNF methionine was removed, since the protein will be expressed as a fusion product that will be cleaved autocatalytically by protease 2A. The structure of the vector is represented in Figure 4A.

3.2. Expression of hGDNF in BHK cells transfected with the SFV-hGDNF vector

Plasmid pSFV-hGDNF was linearized with Spel and used as a template for RNA synthesis using SP6 polymerase as previously described (Liljestrom and Garoff, 1994). Briefly, 1.5 g of linearized pSFV-hGDNF DNA was incubated for 1 h at 37 ° C in SP6 buffer supplemented with 1 mM of m ⁷ G (5 ^' ) ppp (5 ^' ) G (New England Biolabs), DTT 10 mM, a mixture of 1 mM rNTPs, 50 units of RNAse inhibitor (Promega), and 30 units of SP6 RNA polymerase (New England Biolabs) in a final volume of 50 μΐ, producing 50 g of RNA. Approximately 25 g of RNA synthesized in vitro were mixed with 5 x 10 ⁶ BHK-21 cells and electroporated in a 0.4 cm cuvette by applying two consecutive pulses at 800 V and 25 F. These electroporation conditions are used in a manner Routine with the SFV system and allow transfection of more than 95% of the cells. After electroporation, the cells were diluted in 15 ml of complete BHK medium (Glasgow MEM, Gibco BRL, UK, supplemented with 5% FBS, 10% tryptose phosphate broth, 2 mM glutamine, 20 mM HEPES, 100 streptomycin 100 μg / ml and penicillin 100 IU / ml), seeded in 6-well plates (1.5 ml / plate) and incubated at 37 ° C with 5% C0 ₂ . After 4 h, the medium was removed and replaced with 1 ml of complete BHK medium without FBS. 20h later, the supernatants were collected and analyzed by Western blotting with an antibody specific for GDNF (Figure 4B). Very high expression of hGDNF was observed in two duplicate experiments (channels 1 and 2). The protein had a glycosylation pattern similar to that obtained in hGDNF secreted by MDX-12 cells (GDNF lenti), but much more complex than that observed in rat GDNF expressed from a baculovirus vector in insect cells (GDNF of insect) (R&D systems). 3.3 Differential synthesis of proteins in BHK cells transfected with SFV-hGDNF vector

5xl0 ⁶ BHK cells were duplicated with duplicate with SFV-hGDNF RNA and without RNA (control) as described. They were placed on three 35 cm ² plates with 5 x 10 ⁵ cells from each electroporation and incubated with BHK complete medium at 33 ° C with 5% C0 ₂ . In a plate of each electroporation the medium was removed at 4 hours after plating, the cells were washed twice with PBS and 1 ml of the same medium without serum was added. In the second and third plates, the same procedure was followed, but changing the medium at 6 or 8 hours after electroporation. All supernatants were analyzed by Western blotting with antibodies against GDNF, IGFBP-5, or IGFBP-4, a protein that is also normally produced by BHK cells (Figure 5B). The level of hGDNF expression in electroporated cells with SFV-hGDNF from two duplicate experiments was very similar. However, IGFBP-5 could not be detected in the supernatant of cells transfected with SFV-hGDNF. Instead, an elevated expression of IGFBP-5 was detected in the control cells. The expression of other proteins normally secreted by BHK cells, such as IGFBP-4, also disappeared completely in cells transfected with the SFV vector (Figure 5B).

3.4 Optimization

The expression of hGDNF in BHK cells electroporated with SFV-hGDNF was optimized by assay with different temperatures and incubation times (see Table 1) BHK cells were electroporated with SFV-hGDNF RNA as described. Approximately 5 x 10 ⁵ electroporated cells were placed on 35 era ² plates and incubated with BHK complete medium at 33 ° C with 5% C0 ₂ for different times that we will call "Inhibition". After 1 time of inhibition the medium was removed, the plates were washed twice with PBS and 1 ml of BHK complete medium without serum was added. The cells were incubated for different times that we will call "Incubation" and the supernatants were collected. The presence of hGDNF in each supernatant was determined by Western blotting. Since the amount of endogenous proteins present in the culture medium of BHK cells transfected with the SFV-hGDNF vector was very low, 400 µΐ of each supernatant was concentrated by precipitation with trichloroacetic acid. In order to evaluate the effectiveness of the inhibition of the synthesis of endogenous cellular proteins, the presence of IGFBP-4, which is efficiently secreted by BHK cells, was analyzed by Western blotting in the concentrated samples. The relative amount of hGDNF (in unconcentrated samples) and IGFBP-4 (in concentrated samples) was estimated by measuring the optical density (OD) of each band. The highest hGDNF yield with total absence of IGFBP-4 expression was obtained when the inhibition time was 8 h and that of 24 h incubation, incubating the cells in both periods at 33 ° C (Table 1). These conditions were used in purification experiments (part 3.5.)

Table 1: Optimization of hGDNF expression in electroporated BHK cells with SFV-hGDNF

Inhibition Incubation DO Ratio

 GDNF / IGFBP

 -4

rj a Tiem T ^a (° C) Tiemp GDNF IGFBP

 (° C) po o (h) -4

 (h)

37 4 37 24 44.74 12, 32 3, 63 37 8 37 24 33.32 0

 37 4 33 24 57.50 10.49 5.48

 37 8 33 24 42.75 0

 37 4 33 48 70.74 50.39 1.40

 37 8 33 48 86.76 54, 98 1, 58

 33 4 33 24 72.47 35, 40 2, 05

 33 8 33 24 49.04 0

 33 12 33 24 43.78 0

 33 24 33 24 31, 97 14.07 2.27

 33 4 33 48 100, 44 44.22 2.27

 33 8 33 48 67, 65 15.57 4, 34

 33 12 33 48 65, 53 20, 61 3.18

 33 24 33 48 39.51 86.22 0.46

3.5. Purification of hGDNF from the conditioned medium of BHK cells transfected with SFV-hGDNF Purification 1

A total of 10 ⁸ BHK cells were electroporated with 500 of SFV-hGDNF RNA synthesized in vitro as described (20 electroporations of 5 x 10 ⁶ BHK cells with 25 of each RNA). The electroporated cells were pooled, resuspended in a total volume of 200 ml of complete BHK medium, and distributed in 10 culture jars of 75 was ² . After 8 hours of incubation at 33 ° C with 5% C0 ₂ , the medium was removed, the cells were washed twice with 10 ml of PBS (each bottle), and 10 ml of BHK complete medium without FBS was added. 24 h later, the conditioned medium was collected from all the bottles, centrifuged at 1200 rpm to remove cell debris and frozen. Purification of hGDNF was performed from a total volume of 95 ml of conditioned medium of BHK cells transfected with SFV-hGDNF. The medium was thawed, the pH was adjusted to 8.2 with NaOH and filtered through a 0.22 filtration unit μιτι. As in the previous protocol, the sample was passed through the SP-Sepharose resin (0.2 ml). In this case, the resin was packaged in a disposable column (Bio-Rad) and the sample was allowed to flow through the column by gravity at 4 ° C. The column was washed with 10 column volumes (CV) of 10 mM phosphate buffer at pH 8.2, 150 mM NaCl and 5 mM EDTA. Since hGDNF is the main protein present in the conditioned medium, the resin-bound protein was eluted in a single stage with 2 ml of 0.5 M NaCl. Additionally, an additional elution was performed with 1 M NaCl to ensure that all The bound hGDNF is spoken eluted from the resin.

The only protein present in the elution was hGDNF, as detected by SDS-PAGE followed by staining with Coomassie Blue (Figure 6A) and confirmed by Western blotting (Figure 6B). The hGDNF present in the conditioned medium and in the elution of the cation exchange column was quantified by ELISA. In summary, an initial amount of 62 g of hGDNF was started in 95 ml of medium and 16 g of hGDNF was obtained in 2 ml, thus recovering 26% of the protein contained in the initial sample. This global purification process lasted only three days (Figure 8).

Purification 2

A total of 5xl0 ⁸ BHK cells were electroporated with 2500 g of SFV-hGDNF RNA synthesized in vitro as described (100 electroporations of 5xl0 ⁶ BHK cells with 25 g of each RNA). The electroporated cells were pooled, resuspended in a total volume of 600 ml of complete BHK medium, and distributed in 50 culture jars of 75 was ² . After 8 hours of incubation at 33 ° C with 5% C0 ₂ , the medium was removed, the cells were washed twice with 10 ml of PBS (each bottle), and 10 ml of BHK complete medium without FBS was added. 24 h later, the conditioned medium was collected from all the bottles, centrifuged at 1200 rpm to remove cell debris and frozen. Purification of hGDNF was performed from a total volume of 570 ml of conditioned medium of BHK cells transfected with SFV-hGDNF. The medium was thawed, the pH was adjusted to 8.2 with NaOH and filtered through a 0.22 μιτι filtration unit. As in the previous protocol, the sample was passed through the SP-Sepharose resin (0.2 ml). In this case, the resin was packaged in a disposable column (Bio-Rad) and the sample was allowed to flow through the column by gravity at 4 ° C. The column was washed with 10 column volumes (CV) of 10 mM phosphate buffer at pH 8.2, 150 mM NaCl and 5 mM EDTA. Since hGDNF is the main protein present in the conditioned medium, the resin-bound protein was eluted in a single stage with 0.4 ml of 0.5 M NaCl. Additionally, an additional elution was performed with 1 M NaCl to ensure that all The bound hGDNF is spoken eluted from the resin.

 The only protein present in the elution was hGDNF, as detected by SDS-PAGE followed by staining with Coomassie Blue and confirmed by Western blotting. The hGDNF present in the conditioned medium and in the elution of the cation exchange column was quantified by ELISA. In summary, an initial amount of 756 g of hGDNF was started in 570 ml of medium and 445 g of hGDNF were obtained in a volume of 0.4 ml, thus recovering 58% of the protein contained in the initial sample. This global purification process lasted only five days (Figure 8).

3.6 Bioactivity of purified hGDNF from BHK cells transfected with SFV-hGDNF

To check the biological activity of the purified hGDNF, 50 ng / ml was added to the low density culture medium (2 x 10 ³ cells / cm ² ) of PC12 cells grown on collagen coated plates. Figure 7 shows that glycosylated hGDNF induces the growth of neurites in PC12 cells in the same manner as commercial non-glycosylated hGDNF (Invitrogen), which was used as a positive control. 3.7 Stability of purified hGDNF of BHK cells transfected with SFV-hGDNF

 To analyze the stability of the obtained human glycosylated GDNF, 220 ng of purified human glycosylated GDNF from transfected BHK cells feeded with SFV-hGDNF and the same amount of non-glycosylated GDNF from E. coli (ProSpec) were incubated in 220 μΐ of phosphate buffer a pH 7.4 at room temperature. 10 ml aliquots were taken at 24, 48, 96 hours, 1, 2 and 3 weeks and the presence of hGDNF was analyzed by Western blotting. Figure 9 shows an upper panel corresponding to the glycosylated hGDNF and a lower panel corresponding to the non-glycosylated hGDNF. It is possible to appreciate how the majority of the non-glycosylated protein degrades after 24 hours of incubation and disappears after 48 hours. However, glycosylated hGDNF is still present after 3 weeks of incubation at room temperature.

Conclusion :

Since glycosylated hGDNF is not commercially available, methods for purifying glycosylated GDNF (Garbayo et al., 2007 and Ansorena et al., 2009) from mammalian cells have been previously described and the same methodology has been used with some modifications to obtain pure glycosylated hGDNF. However, this methodology is extremely laborious and requires a lot of time to produce high amounts of hGDNF for clinical purposes. In the present study, a new and simple method is proposed to obtain high amounts of purified hGDNF. It has been shown that in BHK cells transfected with an SFV vector expressing hGDNF, this protein is produced at elevated levels in the supernatant. If the cellular medium is removed approximately 8 hours after transfection, hGDNF becomes the only protein expressed in the supernatants of these cells, since the SFV vector induces a strong inhibition of the synthesis of endogenous cellular proteins. This makes purification of hGDNF very simple and effective, especially because the endogenous proteins that were difficult of eliminating in the purification process, such as IGFBP-5, have ceased to be expressed by the producing cells. In addition, the hGDNF produced with this method is highly glycosylated, which makes the protein more stable and probably less immunogenic, unlike the hGDNF produced using bacterial systems.

Glycosylated hGDNF could be very useful for the treatment of Parkinson's disease or other degenerative disorders, since its greater stability suggests that lower doses of this protein would be necessary for therapeutic use compared to non-glycosylated hGDNF.

References Ansorena E, Garbayo E, Lanciego JL, Aymerich MS, Blanco-Prieto MJ. Production of highly pure human glycosylated GDNF in a mammalian cell line. Int J Pharm. 2010 Jan 29; 385 (1-2): 6-11. Epub 2009 Oct 13.;

 Blasey HD, Lundstróm K, Tate S, Bernard AR. Recombinant protein production using the Semliki Forest Virus expression system. Cytotechnology, 1997; 24: 65-72.

 Forsman T, Lautala P, Lundstróm K, Monastyrskaia K, Ouzzine M, Burchell B, Taskinen J, Ulmanen I. Life Sci. 2000 Oct 6; 67 (20): 2473-2484.

Garbayo E, Ansorena E, Lanciego JL, Aymerich MS, Blanco-Prieto MJ. Purification of bioactive glycosylated recombinant glial cell line-derived neurotrophic factor. Int J Pharm 2007; 344: 9-15.

 Liljestrom, P., and H. Garoff. 1991. A ne generation of animal cell expression vectors based on the Semliki Forest virus replicon. Biotechnology (N Y) 9: 1356-61.

Liljestrom P, Garoff H. Expession of proteins using Semliki Forest virus vectors. In Current protocole in molecular biology (FM Ausubel, et al., Eds.), Pp. 16.20.11-16.20.16. Greene Publishing Associates and Wiley Interscience, New York, NY 1994. Lin LF, Doherty DH, Lile JD, Bektesh S, Collins F. GDNF: a glial cell line-derived neurotrophic factor for midbrain dopaminergic neurons. Science 1993; 260: 1130-2.

 Lundstrom K. Semliki Forest virus vectors for large-scale production of recombinant proteins. Methods Mol Med 2003a; 76: 525-43.

 Moretto G, Walker DG, Lanteri P, Taioli F, Zaffagnini S, Xu RY, et al. Expression and regulation of glial-cell-line-derived neurotrophic factor (GDNF) mRNA in human astrocytes in vitro. Cell Tissue Res 1996; 286: 257-62.

 Pushko, P., Parker, M., Ludwig, G. V., Davis, N. L., Johnston, R. E., and Smith, J. F. (1997). Replicon-helper systems from attenuated Venezuelan equine encephalitis virus: expression of heterologous genes in vitro and immunization against heterologous pathogens in vivo. Virology 239: 389-401.

 Rodriguez-Madoz JR, Prieto J, Smerdou C. Semliki forest virus vectors engineered to express higher IL-12 levéis induces efficient elimination of murine colon adenocarcinomas. Mol Ther 2005; 12: 153-63.

Ryan MD, Dre J. Foot-and-mouth disease virus 2A oligopeptide mediated cleavage of an artificial polyprotein. Embo J 1994; 13: 928-33.

 Sajadi A, Bensadoun JC, Schneider BL, Lo Bianco C, Aebischer P. Transient striatal delivery of GDNF via encapsulated cells leads to sustained behavioral improvement in a bilateral model of Parkinson disease. Neurobiol Dis 2006; 22: 119-29.

 Smerdou, C., and P. Liljestrom. 1999. T o-helper RNA system for production of recombinant Semliki forest virus partiols. J Virol 73: 1092-8.

Walsh G, Jefferis R. Post-translational modifications in the context of therapeutic proteins. Nat Biotechnol 2006; 24: 1241-52.

 Xiong, C., Levis, R., Shen, P., Schlesinger, S., Rice, C. M., and Huang, H. V. (1989). Sindbis virus: an efficient, broad host range vector for gene expression in animal cells. Science 243: 1188-1191.

Claims

1. Method for the production of human recombinant GDNF, or a functionally equivalent variant thereof, comprising:

 a) providing eukaryotic cells comprising an alphavirus expression vector, said vector comprising the nucleic acids of i) a 5 'sequence capable of directing the replication of the alphavirus; ii) a sequence coding for non-structural proteins capable of directing the replication of alphaviral RNA; iii) a subgenomic promoter of the alphavirus; iv) a sequence encoding a recombinant human GDNF protein, or a variant f u n c i or n at 1 m e n t and equivalent thereof, operatively linked to the subgenomic promoter that directs the expression of the protein in eukaryotic cells; v) a 3 'sequence capable of directing the replication of the alphavirus;

 b) culturing or incubating said eukaryotic cells in a culture medium until the synthesis of endogenous cellular proteins is inhibited;

 c) remove the supernatant;

 d) culturing or incubating said eukaryotic cells in a culture medium for a period of time, so that the expression of the recombinant GDNF protein is achieved, but without cell death; Y

 e) purify the recombinant GDNF from the culture medium.

2. A method according to claim 1, further comprising a step f) of purification of the recombinant hGDNF protein by chromatography.

3. Method according to any of claims 1-2, wherein the culture or incubation of steps b) or d) is carried out at a temperature between 30 ° and 40 ° C for a period of time from 2 to 50 hours.

4. Method according to any of claims 1-2, wherein the culture or incubation of step b) is carried out at a temperature of 33 ° C for 8 hours. 5. Method according to any of claims 1-4, wherein the culture or incubation of step d) is carried out at a temperature of 33 ° C for 24 hours.

Method according to any one of claims 1 to 5 wherein the conditions of steps b) and d) are selected from the group consisting of:

 (i) step b) is carried out at approximately 37 ° for approximately 8 h and stage d) is carried out at approximately 37 ° for approximately 24 h;

 (ii) step b) is carried out at approximately 37 ° for approximately 8 h and stage d) is carried out at approximately 33 ° for approximately 24 h;

 (iii) step b) is carried out at approximately 33 ° for approximately 8 h and stage d) is carried out at approximately 33 ° for approximately 24 h and

 (iv) step b) is carried out at approximately 33 ° for approximately 12 h and stage d) is carried out at approximately 33 ° for approximately 24 h.

Method according to any of claims 1-6, wherein the alphavirus expression vector further comprises an in vitro transcribed RNA vector.

A method according to any of claims 1-6, wherein the alphavirus expression vector further comprises viral particles comprising alphavirus vector RNA.

9. A method according to any of claims 1-8, wherein the alphavirus expression vector further comprises a promoter that is recognizable by a eukaryotic RNA polymerase.

10. The method of claim 9, wherein the promoter recognizable by a eukaryotic RNA polymerase is the cytomegalovirus (CMV) promoter. 11. A method according to any of claims 1-10, wherein the alphavirus expression vector further comprises a sequence encoding a protein with translation enhancing activity. 12. The method according to claim 11, wherein the sequence encoding a protein with translation enhancing activity is the sequence encoding at least the first 34 amino acids of the Semliki Forest virus (SFV) capsid.

13. A method according to any of claims 11 and 12, wherein the alphavirus expression vector further comprises a sequence encoding a self-cleavage protease or a target sequence for a cellular protease.

14. A method according to claim 13, wherein the sequence encoding a self-cleavage protease or the target sequence for a cellular protease is expressed in phase with the sequence with translation enhancing activity.

15. A method according to any of claims 13-14, wherein the sequence encoding a self-cleavage protease is FMDV 2A autoprotease (FMDV). 16. A method according to any of claims 13-15, wherein the nucleotide sequence encoding the human recombinant GDNF, or a functionally variant equivalent thereof, it is fused in phase and 3 ^' position with the sequence encoding the self-cleavage protease or the target sequence for a cellular protease.

Method according to any of claims 1-16, wherein the alphavirus is SFV.

18. Method according to any of claims 1-17, wherein the eukaryotic cells are mammalian cells selected from BHK, CHO, VERO, and C6 glioma glioma cells.

19. Alphavirus expression vector as defined in any of claims 1-18.

20. Alphavirus expression vector according to claim 19 wherein said vector is cytopathic.

21. Alphaviral particle comprising the nucleic acids defined for the alphavirus expression vector according to claims 1-20.

22. Eukaryotic cell comprising an alphavirus expression vector as defined in any of claims 1-20.

23. Fusion protein comprising the SFV capsid protein bound to human GDNF, or a functionally equivalent variant thereof.

24. Use of the alphavirus expression vector according to claims 19 or 20 for the production of human recombinant GDNF, or functionally equivalent variants thereof.

25. Use of an alphaviral particle according to claim 21, for the production of human recombinant GDNF, or variants functionally equivalent thereof.

Use of a eukaryotic cell according to claim 22, for the production of human recombinant GDNF, or functionally equivalent variants thereof.

A composition comprising human GDNF or a functionally equivalent variant of GDNF wherein the GDNF is glycosylated and where the composition

 (i) comprises a percentage of GDNF by weight with respect to the total protein in the composition greater than 90% and / or

 (ii) is substantially free of IGFBP-4,

 IGFBP-5 and / or IGFBP-7.

A composition according to claim 27 for use in medicine.

29. A composition according to claim 27 for use in the treatment or prevention of a neurodegenerative disorder.