WO1997039629A1 - Viral vectors including polynucleotides encoding neurotrophic factors and uses therefor - Google Patents

Abstract

Viral vectors such as, for example, retroviral vectors, adenoviral vectors, SV40 vectors, and Herpes Virus vectors, which include a polynucleotide encoding a neurotrophic factor, such as, glial cell line derived neurotrophic factor (GDNF). Such vectors may be employed in gene therapy procedures for the treatment of amyotrophic lateral sclerosis or Parkinson's Disease, wherein such vectors are employed in the ex vivo or in vivo transduction of cells.

Description

VIRAL VECTORS INCLUDING POLYNUCLEOTIDES ENCODING NEUROTROPHIC FACTORS AND USES THEREFOR

This application is a continuation-in-part of application Serial No. 08/796,278, filed February 7, 1997, which is a continuation-in-part of application Serial No. 08/636,548, filed April 25, 1996, the contents of which are hereby incorporated by reference in their entireties.

This invention relates to viral vectors, such as retroviral vectors, adenoviral vectors, SV40 vectors, and Herpes Virus vectors, which include polynucleotides encoding neurotrophic factors. More particularly, this invention relates to viral vectors including a polynucleotide encoding a neurotrophic factor, such as, for example, glial cell line- derived neurotrophic factor, or GDNF, which are administered to a host for treating adverse conditions of the nervous system, such as amyotrophic lateral sclerosis and Parkinson's Disease.

BACKGROUND OF THE INVENTION

Amyotrophic lateral sclerosis (ALS) , or Lou Gehrig's Disease, is characterized by a rapid, progressive degeneration of upper and lower motor neurons in the motor cortex and ventral horn of the spinal cord. ALS occurs in familial and sporadic forms with increasing incidence. In the United States, about 25,000 individuals are affected by -

amyotrophic lateral sclerosis. The average survival, time after diagnosis is about three years, and presently there is no cure or successful therapeutic approach to slow the progression of the disease.

Parkinson's Disease is characterized by the progressive degeneration of dopamine synthesizing, or DA, neurons in the substantia nigra. The striatum, a brain region involved in control of movement, becomes depleted in dopamine because the degenerating dopaminergic neurons in the substantia nigra send their axons to this brain region. About 100,000 individuals in the United States are affected by Parkinson's Disease. There is no cure for Parkinson's Disease. Current therapies include pharmacological intervention, surgical brain lesions, and transplantation of neurons. Presently, no therapy is available that will slow the progression of this disease. Recent studies in non-human primates suggest that administration of glial cell line-derived neurotrophic factor to the brain will stimulate growth and function of DA neurons that have not yet degenerated. (Gash, et al., Nature, Vol. 380, pgs. 252-255 (1996); however, glial cell line-derived neurotrophic factor has not been tried in humans with Parkinson's Disease.

Glial cell line-derived neurotrophic factor, or GDNF, is a recently identified member of the TGF-/3 superfamily, (Lin, et al . , Science, Vol. 260, pgs. 1130-1132 (1993)). GDNF was identified originally as a factor that supports the survival and differentiation of dopaminergic neurons in culture. (Lin, et al., 1993,- Lin, et al., J. Neurochem. , Vol. 63, pgs. 758-768 (1994) ) . Recently, GDNF also was reported to target spinal motor neurons and to be present at high levels in the embryonic spinal cord (Choi-Lundberg, et al . , Devel. Brain Res. , Vol. 85, pgs. 80-88 (1995); Henderson, et al., Science, Vol. 266, pgs. 1062-1064 (1994); Yan, et al . , Nature. Vol. 373, pgs. 341-344 (1995)) . GDNF increases the survival of embryonic motor neurons and dopaminergic neurons in vi tro . In vivo, experimentally increased levels of recombinant GDNF protein have been shown to protect facial motor neurons against cell death following peripheral nerve lesions in the rat, decrease the amount of programmed cell death in the motor neuron pool in chick embryos, and protect dopaminergic neurons in adult rat brain following lesions (Henderson, et al . , 1994; Yan, et al., 1995; Oppenheim, et al., Nature, Vol. 373, pgs. 344-346 (1995); Tomac, et al . , Nature. Vol. 373, pgs. 335-339 (1995) ; Beck, et al . , Nature. Vol. 373, pgs. 339-341 (1995)) , and protect adult spinal motor neurons following peripheral nerve lesions in mice. (Li, et al. , Proc. Nat. Acad. Sci. , Vol. 92, pgs. 9771-9775 (1995) .)

Neurotrophic factors, such as GDNF, are potentially valuable agents in the treatment of neurodegenerative disorders (Lindsay, et al . , Exper. Neurol. , Vol. 124, pgs. 103-118 (1993)) . Judging from their effects in culture and on injured neurons in rodent brains, neurotrophic factors may offer protective effects against cellular damage and disease in the human. Neurotrophic factors also may stimulate regeneration of damaged or diseased neurons or induce sprouting of fibers from neighboring healthy neurons. In spite of evidence suggesting that increased levels of neurotrophic factors may be neuroprotective in the diseased and aging brain, relatively few studies have demonstrated therapeutic effects of neurotrophic factors in animal models of Parkinson's Disease and amyotrophic lateral sclerosis.

SUMMARY OF THE INVENTION

The present invention is directed to gene therapy for amyotrophic lateral sclerosis and Parkinson's Disease employing viral vectors including a polynucleotide encoding a neurotrophic factor, such as glial cell line-derived neurotrophic factor, or GDNF, brain derived neurotrophic factor (BDNF) , neurotrophin (NT) -4/5, NT-3, ciliary neurotrophic factor (CNTF) , insulin-like growth factors (IGF), transforming growth factor (TGF) -α or β , cardiotropin and/or hepatocyte growth factor. Such vectors may be administered in vivo, or may transduce cells in vi tro for subsequent injection in vivo, such as myoblasts (for treating amyotrophic lateral sclerosis or Parkinson's Disease) , or astrocytes, fibroblasts, and progenitor cells (for treating Parkinson's Disease) .

BRIEF DESCRIPTION OF THE DRAWINGS

The invention now will be described with respect to the drawings, wherein:

Figures IA and IB are Northern blots using GDNF and neomycin phosphotransferase (neo^R) cDNAs, respectively, as probes of PA317 producer cell clones generating the retroviruses GlGdSvNa or GlGdFSvNa;

Figure 2 depicts the staining for β-galactosidase of neurons and astrocytes which were infected with the adenoviral vector AdRSVβ-gal;

Figure 3 depicts DA neurons infected with AvlLacZ4 at 100 pfu which are stained immunocytochemically for tyrosine hydroxylase 4 days after infection;

Figures 4A, 4B, and 4C depict the staining of a control culture of uninfected neurons, a culture of neurons infected with an adenoviral vector including DNA encoding human GDNF, and a culture of neurons infected with an adenoviral vector including DNA encoding a deletion mutant of human GDNF, respectively;

Figure 5 is a blot which depicts RT-PCR of mRNA levels from expression of the LacZ or human GDNF genes following adenoviral infection of PC12 cells at varying particle numbers per cell;

Figure 6 is a Western blot for detecting GDNF in PC12 cells infected with the adenoviral vectors AvlLacZ4 or AvS6Gd;

Figure 7 depicts low and high magnifications of adenoviral infected cells in an injection site in the rat striatum 60 days after infection with 4xl0⁶ pfu of AvlLacZ4; Figure 8 depicts cells expressing the LacZ gene in striatum (injection site) and in DA neurons in substantia nigra (cells stained immunocytochemically for tyrosine hydroxylase, the rate limiting enzyme in DA biosynthesis) due to retrograde transport of vector and/or protein at 4 days following injection of 4xl0⁷ pfu of AvlLacZ4;

Figure 9 is a graph of the number of TH-IR(DA) neurons counted in E14.5 mesencephalon cultures maintained on 50% conditioned medium of PC12 cells infected with AvS6Gd, AvSdGD, or mock infected cells;

Figure 10 is a graph of the effect of GDNF adenoviral gene therapy, compared with mutant GDNF and no virus therapy of rats, on survival at day 49 of neurons, in the substantia nigra that were fluorogold labeled on day 1 of the experiment, followed by a unilateral striatal injection of 6- OHDA on day 7, and the effect of the gene therapy is expressed as a ratio of treated side/untreated side,-

Figure ll depicts low and high magnifications of fluorogold-positive (FG+) cells, in the substantia nigra of rats, that were fluorogold labeled on day 1 of the experiment referred to in the description of Figure 9, followed by a unilateral striatal injection of 6-OHDA on day 7;

Figure 12 depicts sections from striatum and substantia nigra of rats injected with striatal fluorogold and 6-OHDA, and treated with an adenoviral vector injected in the substantia nigra or untreated. (A) substantia nigra 49 days after fluorogold injection, (i) FG, (ii) TH-FITC. Most large FG+ cells are TH+ neurons (arrows) . (B) Loss of TH-IR fibers (arrow) in the striatum 42 days after 6-OHDA injection. (C- G) FG+ cells in the anterior substantia nigra from the unlesioned (C) and lesioned (D-G) sides 42 days after 6-OHDA injection. Many large, FG+ cells (DA neurons) are visible on the unlesioned side (C) and lesioned side of a rat treated with AvS6Gd (D, arrows) , while fewer large FG+ cells but numerous small FG+ cells (atrophied neurons, microglia, or other non-neuronal cells, arrowheads) are apparent in.rats treated with AvlLacZ4 (E) , AvSdGD (F) , or uninjected rats (G) . (H) Blue nuclei and cells dorsal to and within the medial substantia nigra and lateral VTA 10 days after injection of AvlLacZ4. Inset of (H) , several TH+ cells, several blue cells, and one TH+/blue cell (arrow) . Scale bars are 50μm (A, and insets of C-H), 1,000 μm (B) , 100 μm (C-G) , and 500 μm (H) ,-

Figure 13 shows host reactions near the needle track and the substantia nigra in rats injected with AvS6Gd, AvlLacZ4, or AvSdGD. Mild host responses were observed around the needle track in all rats (representative sections from AvS6Gd(A) , AvlLacZ4(B), and AvSdGD(C) ) . Near the substantia nigra, host responses varied from none to moderate. Sections representing the most severe responses observed in each group are shown: mild for AvlLacZ4 (E) , and moderate for AvS6Gd(D) and AvSdGD(F) . Arrows point to areas of host reactions. Scale bar represents 500 μm;

Figure 14 is a graph of amphetamine - induced rotation behavior following injection of rats with 6-OHDA and AvS6Gd, AvSdGD, or AvlLacZ4;

Figures 15A and 15B are schematics which show the construction of plasmid pAvGdnBg02i from pAvS6Gd;

Figure 16 is a map of plasmid pEMC-F;

Figure 17 is a map of plasmid pAvGdnBg02i;

Figure 18 shows RT-PCR and PCR results on RNA and DNA using LacZ primers or β-actin primers on RNA and DNA obtained from the striata of rats injected with the adenoviral vector AdGDNF-ires-LacZ,- and

Figure 19 shown RT-PCR and PCR results on RNA and DNA using human GDNF primers or β-actin primers on RNA and DNA obtained from the striata of rats injected with the adenoviral vector AdGDNF-ires-LacZ.

DETAILED DESCRIPTION OF THE INVENTION In accordance with an aspect of the present invention, there is provided a viral vector including a polynucleotide encoding a neurotrophic factor.

The term "polynucleotide" as used herein means a polymeric form of nucleotide of any length, and includes ribonucleotides and deoxyribonucleotides . Such term also includes single- and double-stranded DNA, as well as single- and double-stranded RNA. The term also includes modified polynucleotides such as methylated or capped polynucleotides.

Neurotrophic factors which may be encoded by the polynucleotide include, but are not limited to, glial cell line-derived neurotrophic factor (GDNF), NT-4/5, NT-3, CNTF, BDNF, IGF, TGF-/3, cardiotropin, hepatocyte growth factor, and derivatives and analogues thereof. In one embodiment, the neurotrophic factor is selected from the group consisting of glial cell line-derived neurotrophic factor, NT-4/5, NT-3, CNTF, and derivatives and analogues thereof.

In one embodiment, the neurotrophic factor is a mammalian neurotrophic factor, which includes, but is not limited to, human neurotrophic factors, and neurotrophic factors of non-human primates.

Viral vectors which may be employed include RNA virus vectors (such as retroviral vectors) , and DNA virus vectors (such as adenoviral vectors, SV40 vectors, and Herpes Virus vectors) . When an RNA virus vector is employed, in constructing the vector, the polynucleotide encoding the neurotrophic factor is in the form of RNA. When a DNA virus vector is employed, in constructing the vector, the polynucleotide encoding the neurotrophic factor is in the form of DNA.

In one embodiment, the viral vector is a retroviral vector. Examples of retroviral vectors which may be employed include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma -

Virus, avian leukosis virus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus. The vector is generally a replication incompetent retroviral particle.

Retroviral vectors are useful as agents to mediate retroviral-mediated gene transfer into eukaryotic cells. Retroviral vectors are generally constructed such that the majority of sequences coding for the structural genes of the virus are deleted and replaced by the gene(s) of interest. Most often, the structural genes (i.e., gag, pol, and env), are removed from the retroviral backbone using genetic engineering techniques known in the art. This may include digestion with the appropriate restriction endonuclease or, in some instances, with Bal 31 exonuclease to generate fragments containing appropriate portions of the packaging signal.

These new genes have been incorporated into the proviral backbone in several general ways. The most straightforward constructions are ones in which the structural genes of the retrovirus are replaced by a single gene which then is transcribed under the control of the viral regulatory sequences within the long terminal repeat (LTR) . Retroviral vectors have also been constructed which can introduce more than one gene into target cells. Usually, in such vectors one gene is under the regulatory control of the viral LTR, while the second gene is expressed either off a spliced message or is under the regulation of an internal promoter. Alternatively, two genes may be expressed from a single promoter by the use of an Internal Ribosome Entry Site.

Efforts have been directed at minimizing the viral component of the viral backbone, largely in an effort to reduce the chance for recombination between the vector and the packaging-defective viral genome integrated in packaging cells. The integrated packaging-defective viral genome is necessary to provide the gag, pol, and env genes .of a retrovirus, which have been deleted from the vector itself.

Examples of retroviral vectors which may be employed include retroviral vectors generated from retroviral plasmid vectors derived from retroviruses including, but not limited to, Moloney Murine Leukemia Virus vectors such as those described in Miller, et al . , Biotechniques, Vol. 7, pgs. 980- 990 (1989) , and in Miller, et al . , Human Gene Therapy, Vol. 1, pgs. 5-14 (1990) .

In a preferred embodiment, the retroviral plasmid vector may include at least four cloning, or restriction enzyme recognition sites, wherein at least two of the sites have an average frequency of appearance in eukaryotic genes of less than once in 10,000 base pairs; i . e. , the restriction product has an average DNA size of at least 10,000 base pairs. Preferred cloning sites are selected from the group consisting of Notl, SnaBI, Sail, and Xhol. In a preferred embodiment, the retroviral plasmid vector includes each of these cloning sites. Such vectors are further described in U.S. Patent Application Serial No. 08/340,805, filed November 17, 1994, and in PCT Application No. W091/10728, published July 25, 1991, entitled "Novel Retroviral Vectors," and incorporated herein by reference in their entireties.

When a retroviral plasmid vector including such cloning sites is employed, there may also be provided a shuttle cloning vector which includes at least two cloning sites which are compatible with at least two cloning sites selected from the group consisting of Notl, SnaBI, Sail, and Xhol located on the retroviral vector. The shuttle cloning vector also includes at least one desired gene which is capable of being transferred from the shuttle cloning vector to the retroviral vector.

The shuttle cloning vector may be constructed from a basic "backbone" vector or fragment to which are ligated one or more linkers which include cloning or restriction enzyme recognition sites. Included in the cloning sites are the compatible, or complementary cloning sites hereinabove described. Genes and/or promoters having ends corresponding to the restriction sites of the shuttle vector may be ligated into the shuttle vector through techniques known in the art.

The shuttle cloning vector can be employed to amplify DNA sequences in prokaryotic systems. The shuttle cloning vector may be prepared from plasmids generally used in prokaryotic systems and in particular in bacteria. Thus, for example, the shuttle cloning vector may be derived from plasmids such as pBR322; pUC 18; etc.

The retroviral plasmid vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al. , Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter ( e. g. , cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, β-actin, and brain tissue specific promoters) . Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, TK promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

The retroviral plasmid vector then is employed to transduce a packaging cell line to form a producer cell line. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, φ-2 , φ-AM, PA12, T19-14X, VT-19-17-H2, φ CRE, φ CRIP, GP+E-86, GP+envAml2, and DAN cell lines, as described in Miller, Human Gene Therapy. Vol. 1, pgs. 5-14 (1990). The retroviral plasmid vector containing the polynucleotide encoding the neurotrophic factor, transduces the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaP0₄ precipitation.

The packaging cells thus become producer cells which generate retroviral vectors which include a polynucleotide encoding a neurotrophic factor.

The retroviral vectors, which include at least one polynucleotide encoding a neurotrophic factor, may be employed in treating disorders involving degeneration of the nervous system, including amyotrophic lateral sclerosis and Parkinson's Disease.

When employed to treat amyotrophic lateral sclerosis, the at least one neurotrophic factor may, in one embodiment, be selected from the group consisting of glial cell line- derived neurotrophic factor, BDNF, NT-4/5, NT-3, CNTF, IGF, cardiotropin, and hepatocyte growth factor. In one embodiment, the neurotrophic factor is glial cell line- derived neurotrophic factor.

The retroviral vectors are administered to a host in an amount which is effective to treat amyotrophic lateral sclerosis in a host. The host may be an animal host, which includes human and non-human primate hosts. Such administration may be such that the neurotrophic factor expressed by the retroviral vectors may be delivered to motor neurons, such as by intramuscular administration or by injection into the cerebrospinal fluid. The retroviral vectors then may transduce cells, such as, for example, myoblasts, which are located in close proximity to the terminals of the motor neurons.

In general, the retroviral vectors are administered as part of a preparation having a titer from about IO⁵ cfu/ml to about 10⁷ cfu/ml. When administered intramuscularly, such preparation is administered in an amount of from about 1 ml to about 2 ml. The exact dosage to be administered is dependent upon a variety of factors, including the age, weight, and sex of the patient, and the stage and severity of amyotrophic lateral sclerosis in the patient.

The retroviral vectors also may be administered in conjunction with an acceptable pharmaceutical carrier, such as, for example, saline solution, protamine sulfate (Elkins- Sinn, Inc., Cherry Hill, N.J.), water, aqueous buffers, such as phosphate buffers and Tris buffers, or Polybrene (Sigma Chemical, St. Louis, MO) . The selection of a suitable pharmaceutical carrier is deemed to be apparent to those skilled in the art from the teachings contained herein.

In another alternative, retroviral producer cells, such as those derived from the packaging cell lines hereinabove described, which include a polynucleotide encoding a neurotrophic factor, may be administered to a host. Such producer cells may be administered in close proximity to motor neurons or their terminals, such as by intramuscular administration or by injection into the cerebrospinal fluid. The producer cell line then produces retroviral vectors including a polynucleotide encoding a neurotrophic factor in vivo, whereby such retroviral vectors transduce cells, such as myoblasts, which are located in close proximity to the terminals of the motor neurons.

In another aspect of the present invention, amyotrophic lateral sclerosis may be treated by administering to a host cells which have been transduced ex vivo with at least one polynucleotide encoding a neurotrophic factor. Preferably, the cells have been transduced with a viral vector, such as a retroviral vector as hereinabove described.

Cells which may be transduced with the retroviral vector including at least one polynucleotide encoding a neurotrophic factor include, but are not limited to, myoblasts, fibroblasts, Schwann cells, cells from clonal cell lines, and stem cells. Preferably, myoblasts are obtained from the patient suffering from amyotrophic lateral sclerosis, are transduced with the retroviral vectors including at least one polynucleotide encoding a therapeutic agent, and then are returned to the patient. In general, the myoblasts are contacted in vi tro with about 2.5 ml of retroviral supernatant, containing from about IO⁶ to about IO⁷ cfu/ml of retrovirus, for every IO⁶ myoblasts in culture. From about 5xl0⁹ to about 5xl0¹⁰, preferably from about lxlO¹⁰ to about 2.5xl0¹⁰, myoblasts are transduced with the retroviral vectors. The transduced myoblasts, which express the at least one neurotrophic factor, then are grafted into the muscle of the patient in an amount of from about lxlO⁸ to about 5χl0⁸ cells/muscle, whereby the grafted myoblasts express the at least one neurotrophic factor in vivo.

When the retroviral vectors are employed to treat Parkinson's Disease, the at least one neurotrophic factor may, in one embodiment, be selected from the group consisting of glial cell line-derived neurotrophic factor, NT-4/5, NT-3, and TGF-jS. In one embodiment, the neurotrophic factor is glial cell line-derived neurotrophic factor.

In one embodiment, the retroviral vectors are employed to transduce cells in vi tro, followed by the grafting or injection of the transduced cells into the brain of a patient. Cells which may be transduced with the retroviral vectors in vi tro, include, but are not limited to, astrocytes; fibroblasts; myoblasts; oligodendrocytes; glial cells; neuronal tumor cell lines such as PC12 cells (ATTC No. CRL 1721) ; immortalized neuronal cell lines such as those described by Martinez-Serrano, et al. , J. Neurosc. , Vol. 15, pgs. 5668-5680 (1995) and Frederiksen, et al., Neuron, Vol. l, pgs. 439-448 (1988) ,^■ clonal glial cell lines such as described by Engele et al., J. Neuroscience Research, Vol. 43, pgs. 576-586 (1996) ; embryonic stem cells and stem cell lines, such as those described by Jones-Villeneuve, et al., J. Cell. Biol.. Vol. 94, pgs. 253-262 (1982) and Bain, et al., Devel. Biol.. Vol. 168, pgs. 342-357 (1995); and neuronal and glial progenitor cells, such as those described - by Reynolds and Weiss, Science. Vol. 255, pgs. 1707-1710 (1992) ; Ray, et al. , Proc. Natl. Acad. Sci.. Vol. 90, pgs. 3602-3606 (1993); Raff, et al. , Devel. Biol .. Vol. 106, pgs. 53-60 (1984) , and Engele, et al., J. Neurosc.. Vol. 11, pgs. 3070-3078 (1991) .

The cells are transduced with the retroviral vectors in vi tro in an amount of about 2.5 ml of retroviral supernatant, containing from about IO⁶ to about IO⁷ cfu/ml of retrovirus, for every IO⁶ cells in culture. From about lxlO⁸ to about 5xl0¹⁰ cells, preferably from about lxlO⁵ to about lxlO¹⁰ cells are transduced with the retroviral vectors. The transduced cells then are administered to the patient . Such cells are administered in conjunction with an acceptable pharmaceutical carrier. The transduced cells, which express the at least one neurotrophic factor, then are grafted, such as, for example, by injection, into the brain of the patient, whereby the grafted cells express the at least one neurotrophic factor in vivo. The expression of such neurotrophic factor(s) in the brain stimulates sprouting of dopaminergic fibers from neurons, and retards dopaminergic neuronal degeneration in Parkinson's Disease.

In another embodiment, the transduced cells may be mixed with neurons, including dopaminergic neurons, and then administered into the brain, preferably by injection. The transduced cells, which express at least one neurotrophic factor, improve the survival and function of dopaminergic neurons grafted into the brain.

In one embodiment, mesencephalic astrocytes isolated from the brain are transduced with a retroviral vector including the human GDNF gene. The cells then are expanded by stimulation with bovine FGF according to the procedure described in Engele, et al. , Devel. Biol. , Vol. 152, pgs. 363-372 (1992) . The expanded transduced astrocytes then are co-grafted with dopaminergic neurons, which may be fetal dopaminergic neurons, into the brain. The co-grafting of the astrocytes which have been genetically engineered with the human GDNF gene improves the survival and function of the dopaminergic neurons .

In another embodiment, the viral vector is an adenoviral vector.

The adenoviral vector which is employed may, in one embodiment, be an adenoviral vector which includes essentially the complete adenoviral genome (Shenk et al . , Curr. TOP. Microbiol . Immunol.. 111(3) : 1-39 (1984) . Alternatively, the adenoviral vector may be a modified adenoviral vector in which at least a portion of the adenoviral genome has been deleted.

In the preferred embodiment, the adenoviral vector comprises an adenoviral 5' ITR; an adenoviral 3' ITR; an adenoviral encapsidation signal; a DNA sequence encoding a neurotrophic factor; and a promoter controlling the DNA sequence encoding a neurotrophic factor. The vector is free of at least the majority of adenoviral El and E3 DNA sequences, but is not free of all of the E2 and E4 DNA sequences, and DNA sequences encoding adenoviral proteins promoted by the adenoviral major late promoter.

In one embodiment, the vector also is free of at least a portion of at least one DNA sequence selected from the group consisting of the E2 and E4 DNA sequences .

In another embodiment, the vector is free of at least the majority of the adenoviral El and E3 DNA sequences, and is free of a portion of the other of the E2 and E4 DNA sequences .

In still another embodiment, the gene in the E2a region that encodes the 72 kilodalton DNA binding protein is mutated to produce a temperature sensitive protein that is active at 32°C, the temperature at which the viral particles are produced. This temperature sensitive mutant is described in Ensinger et al . , J. Virology. 10:328-339 (1972) , Van der Vliet et al . , J. Virology. 15:348-354 (1975) , and Friefeld et al . , Virology. 124:380-389 (1983) .

Such a vector, in a preferred embodiment, is constructed first by constructing, according to standard techniques, a shuttle plasmid which contains, beginning at the 5' end, the "critical left end elements," which include an adenoviral 5' ITR, an adenoviral encapsidation signal, and an Ela enhancer sequence; a promoter (which may be an adenoviral promoter or any other promoter) ; a multiple cloning site (which may be as herein described) ,^• a poly A signal; and a DNA segment which corresponds to a segment of the adenoviral genome. The vector also may contain a tripartite leader sequence. The DNA segment corresponding to the adenoviral genome serves as a substrate for homologous recombination with a modified or mutated adenovirus, and such sequence may encompass, for example, a segment of the adenovirus 5 genome no longer than from base 3329 to base 6246 of the genome. The plasmid may also include a marker gene and an origin of replication. The origin of replication may be a bacterial origin of replication. Representative examples of such shuttle plasmids include pAvS6, which is described in published PCT Application Nos. W094/23582, published October 27, 1994, and W095/09654, published April 13, 1995, and U.S. Patent No. 5,543,328. The DNA sequence encoding a neurotrophic factor may then be inserted into the multiple cloning site to produce a plasmid vector.

This construct is then used to produce an adenoviral vector. Homologous recombination is effected with a modified or mutated adenovirus in which at least the majority of the El and E3 adenoviral DNA sequences have been deleted. Such homologous recombination may be effected through co- transfection of the plasmid vector and the modified adenovirus into a helper cell line, such as 293 cells (ATCC No.CRL 1573) , which includes the Ela and Elb DNA sequences, which are necessary for viral replication, by electroporation, CaP0₄ precipitation, microinjection, or through proteoliposomes. Upon such homologous recombination, a recombinant adenoviral vector is formed that includes DNA sequences derived from the shuttle plasmid between the Not I site and the homologous recombination fragment, and DNA derived from the El and E3 deleted adenovirus between the homologous recombination fragment and the 3' ITR.

In one embodiment, the homologous recombination fragment overlaps with nucleotides 3329 to 6246 of the adenovirus 5 (ATCC VR-5) genome.

Through such homologous recombination, a vector is formed which includes an adenoviral 5' ITR, an adenoviral encapsidation signal; an Ela enhancer sequence; a promoter; a DNA sequence encoding a neurotrophic factor; a poly A signal; adenoviral DNA free of at least the majority of the El and E3 adenoviral DNA sequences; and an adenoviral 3' ITR. The vector also may include a tripartite leader sequence.

The shuttle plasmid vector hereinabove described may include a multiple cloning site to facilitate the insertion of the DNA sequence encoding the neurotrophic factor into the cloning vector. In general, the multiple cloning site includes "rare" restriction enzyme sites; i.e., sites which are found in eukaryotic genes at a frequency of from about one in every 10,000 to about one in every 100,000 base pairs. An appropriate vector is thus formed by cutting the cloning vector by standard techniques at appropriate restriction sites in the multiple cloning site, and then ligating the DNA sequence encoding a neurotrophic factor into the cloning vector.

The DNA sequence encoding a neurotrophic factor is under the control of a suitable promoter, which may be selected from those herein described, or such DNA may be under the control of its own native promoter.

In one embodiment, the adenovirus may be constructed by using a yeast artificial chromosome (or YAC) containing an adenoviral genome according to the method described in Ketner, et al . , PNAS. Vol. 91, pgs. 6186-6190 (1994), in conjunction with the teachings contained herein. In this embodiment, the adenovirus yeast artificial chromosome is produced by homologous recombination in vivo between adenoviral DNA and yeast artificial chromosome plasmid vectors carrying segments of the adenoviral left and right genomic termini. A DNA sequence encoding a neurotrophic factor then may be cloned into the adenoviral DNA. The modified adenoviral genome then is excised from the adenovirus yeast artificial chromosome in order to be used to generate adenoviral vector particles as hereinabove described.

The polynucleotide encoding the neurotrophic factor is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; the cytomegalovirus (CMV) promoter; the Rous Sarcoma Virus (RSV) promoter; the histone promoter; the polIII promoter, the /3-actin promoter; inducible promoters, such as the MMTV promoter, the metallothionein promoter; heat shock promoters; adenovirus promoters; the albumin promoter; the ApoAI promoter; B19 parvovirus promoters; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter,- retroviral LTRs; human growth hormone promoters, and the MxlFN inducible promoter. The promoter also may be the native promoter which controls the polynucleotide encoding the neurotrophic factor.

The adenoviral vectors hereinabove described may be employed to treat amyotrophic lateral sclerosis or Parkinson's Disease in a host, which may be an animal host, including human and non-human primate hosts. In one embodiment, the adenoviral vectors are administered to a host in an amount which is effective to treat amyotrophic lateral sclerosis in a host. Such administration may be such that the neurotrophic factor expressed by the adenoviral vectors may be delivered to motor neurons, such as by intramuscular, intrathecal, subdural, or intraparenchymal injection.

The adenoviral vectors then may transduce cells which are located in close proximity to the motor neurons, such as myoblasts as hereinabove described, myotubes, Schwann cells, satellite cells or nerve terminals of motor neurons.

In general, the adenoviral vectors are administered in an amount of at least IO⁸ pfu/ml, and in general, such amount does not exceed 5xl0¹⁰ pfu/ml. Preferably, the adenoviral vectors are administered in an amount of from about IO⁹ pfu/ml to about IO¹⁰ pfu/ml. The exact dosage to be administered is dependent upon a variety of factors, including the age, weight, and sex of the patient, the route of administration, and the stage and severity of amyotrophic lateral sclerosis in the patient. The adenoviral vectors may be administered in conjunction with an acceptable pharmaceutical carrier, such as those hereinabove described. In general, the preparation including the adenoviral vectors is administered in an amount of from about 1 ml to about 2 ml.

In another embodiment, amyotrophic lateral sclerosis may be treated by administering to a host cells which have been transduced ex vivo with an adenoviral vector including at least one polynucleotide encoding a neurotrophic factor. The cells which may be transduced ex vivo with the adenoviral vectors include myoblasts. Preferably, the myoblasts are obtained from the patient suffering from amyotrophic lateral sclerosis, are transduced with the adenoviral vectors including at least one polynucleotide encoding a therapeutic agent, and then are returned to the patient. The myoblasts in general are contacted in vitro with about 2.5 ml of an adenoviral preparation having a titer of from about IO⁶ to about IO⁷ pfu/ml, for every IO⁶ myoblasts in culture. From about 5xl0⁹ to about 5xl0¹⁰, preferably from about lxlO¹⁰ to about 2.5xl0¹⁰ myoblasts are transduced with the adenoviral vectors. The transduced myoblasts then are grafted into the muscle of the patient, in an amount of from about lxlO⁸ to about 5xl0⁸ cells/muscle, whereby the grafted myoblasts express the at least one neurotrophic factor in vivo .

In another embodiment, the adenoviral vectors may be administered in vivo for treating Parkinson's Disease. In this embodiment, the neurotrophic factor may be selected from those hereinabove described, and in a preferred embodiment, may be glial cell line-derived neurotrophic factor.

The adenoviral vectors are administered to a host in vivo in an amount effective to treat Parkinson's Disease in a host. The host may be an animal host, including human and non-human primate hosts. In general, the adenoviral vectors are administered in an amount of at least IO⁷ pfu and in general such amount does not exceed IO¹² pfu. In general, the adenoviral vectors are administered in an acceptable pharmaceutical carrier, and the preparation containing the adenoviral vectors and the pharmaceutical carrier is administered to 4 to 12 injection sites in the host brain, in an amount of from about 10 μl to about 100 μl per injection site. In general, the adenoviral vectors are administered in a total amount of from about IO⁷ pfu to about 10¹² pfu. In one embodiment, the adenoviral vectors are injected stereotaxically into the striatum or near the substantia nigra, whereby such adenoviral vectors will transduce cells in the striatum or substantia nigra, including dopaminergic neurons. Alternatively, the adenoviral vectors may be administered to the ventricles, or the adenoviral vectors may be administered to the internal carotid artery. The transduced cells then express the neurotrophic factor, thereby supporting the growth and/or function of dopaminergic neurons .

In another embodiment the adenoviral vectors transduce cells in vi tro, followed by the grafting of the transduced cells into the brain of a patient. Cells which may be transduced with the adenoviral vectors in vi tro include., but are not limited to, astrocytes,- fibroblasts; myoblasts; oligodendrocytes; glial cells; neuronal tumor cell lines such as PC12 cells (ATCC No. 1721) ; immortalized neuronal cell lines such as those described by Martinez-Serrano, et al. (1995) and Frederiksen, et al. (1988); clonal glial cell lines such as those described by Engele, et al. (1996); embryonic stem cells and stem cell lines such as those described by Jones-Villeneuve, et al. (1982) and Bain, et al. (1995) ; and neuronal and glial progenitor cells, such as those described by Reynolds, et al. (1992), Ray, et al. (1993), Raff, et al. (1984), and Engele, et al. (1991).

In general, the cells are transduced with the adenoviral vectors in vi tro by contacting such cells with about 2.5 ml of an adenoviral preparation having a titer of from about IO⁷ to about IO¹⁰ pfu/ml, for every IO⁶ cells in culture. From about lxlO⁸ to about 5xl0¹⁰, preferably from about lxlO⁹ to about lxlO¹⁰ cells are transduced with the adenoviral vectors. The transduced cells then are administered to the patient. The cells are administered in conjunction with an acceptable pharmaceutical carrier, such as those hereinabove described. The transduced cells, which express the at least one neurotrophic factor then are grafted, such as, for example, by injection, into the brain of the patient, whereby the grafted cells express the at least one neurotrophic factor in vivo, thereby stimulating the sprouting of dopaminergic fibers from neurons, and retarding dopaminergic neuronal degeneration in Parkinson's Disease.

In another embodiment, the transduced cells may be co- administered or co-grafted with dopaminergic neurons into the brain, as hereinabove described, whereby the transduced cells which express the at least one neurotrophic factor improve the survival and function of dopaminergic neurons grafted into the brain. In another embodiment, the viral vector is an SV40.viral vector. Examples of SV40 viral vectors which may be employed include, but are not limited to, those described in published PCT Application No. WO95/30762, published November 16, 1995, and in published PCT Application No. WO96/20598, published July 11, 1996, the contents of which are hereby incorporated by reference. The SV40 viral vectors may include DNA encoding the neutrophic factors as hereinabove described, as well as the promoters hereinabaove described which control the DNA sequences encoding the neurotrophic factors. Such vectors also may be employed in transducing cells in vivo or in vi tro for the treatment of Parkinson's Disease or amyotrophic lateral sclerosis in manners hereinabove described with respect to the use of retroviral vectors and adenoviral vectors.

EXAMPLES

The invention now will be described with respect to the following examples; however, the scope of the present invention is not intended to be limited thereby.

Example l Construction of Retroviral and Adenoviral Vectors Including Human GDNF cDNA A. Construction of human GDNF cDNA by PCR

The DNA sequence of human GDNF cDNA was obtained from GenBank (Accession No. L15306) . A series of overlapping oligonucleotides were synthesized for construction of the human GDNF cDNA. In order to synthesize an intact human GDNF cDNA, two rounds of PCR were performed. PCR was employed according to the following protocol. The reaction volume was 100 μl. The melting step was carried out at 95°C for l minute, the annealing step was carried out at 55°C for l minute, and the extension step was carried out at 72°C for 1 minute. The PCR was run for 25 to 40 cycles. At the end of the last cycle, the reaction was extended at 72°C for 10 minutes. Fragment A was obtained from the first round of PCR using primers YNC 191, YNC 192, YNC 194, YNC 195, and YN.C196. Fragment A contains the human GDNF cDNA sequence from nucleotides 1 to 171. This fragment also contains a black beetle virus (BBV) translation enhancer element (Chang, et al . , J . Virol.. Vol. 54, pgs. 3358-3369 (1990)). The sequences of the primers used in constructing Fragment A were as follows:

YNC 191 : 5 TAA GAA TTC GCG GCC GCT CTA GAC ATA TGT TTT - 3'

Notl Xbal Ndel

YNC 192 : 5 ATA ATC CTC TGG CAT ATT TGA GTC ACT GCT - 3'

YNC 194 : 5 TAA GAA TTC GCG GCC GCT CTA GAC ATA TGT TTT CGA AAC AAA

Notl Xbal Ndel BBV enhancer TAA AAC AGA AAA GCG AAC CTA AAC AAT GAA GTT ATG GGA TGT

BBV enhancer TGT GGC TGT CTG C - 3 ' YNC 195: 5' - ATG AAG TTA TGG GAT GTC GTG GCT GTC TGC CTG GTG CTG CTC CAC ACC GCG TCC GCC TTC CCG CTG CCC GCC GGT AAG AGG CCT CCC GAG GCG CCC GCC G -3' YNC 196 : 5' - ATA ATC CTC TGG CAT ATT TGA GTC ACT GCT CAG CGC GAA GGG CGC GCG GCG GCG GCC GAG GGA GCG GTC TTC GGC GGG CGC CTG GGG AGG CCT CTT ACC GG -3'

Fragments B (nucleotide 142 to nucleotide 447) and C (nucleotide 418 to nucleotide 636) were made by PCR using a set of primers YNC 193, YNC 197, YNC 198, YNC 199, YNC 200, YNC 205, YNC 206, and YNC 208, and a set of primers YNC 201, YNC 202, YNC 203, YNC 204, YNC 207, YNC 209, YNC 210, and YNC 211, respectively. Fragment C has Sail, Bglll, and Clal sites downstream of the stop codon of human GDNF cDNA. Fragments A and B have 30 nucleotides at the 3' end that overlap the downstream fragments so that Fragments A, B, and C can be annealed and ligated to form an intact human GDNF cDNA by the second round of PCR using the end primers YNC 191 and YNC 211. A human GDNF cDNA with an IBI flag sequence (International Biotechnologies, Inc., New Haven, CT) downstream of the cDNA was made by PCR using the cDNA described above as a template and primers YNC 191, YNC 218, and YNC 219 as primers. The IBI flag sequence encodes amino acids Asp, Tyr, Lys, Asp, Asp, Asp, Asp, Lys, and two consecutive stop codons. The sequence of the pr-imers employed in constructing Fragments B and C, and the human GDNF cDNA with the IBI flag sequence were as follows :

YNC 193: AGC AGT GAC TCA AAT ATG CCA GAG GAT TAT - 3' YNC 197: AGC AGT GAC TCA AAT ATG CCA GAG GAT TAT CCT GAT CAG TTC

GAT GAT GTC ATG GAT TTT ATT CAA GCC ACC ATT AAA AGA CTG

AAA AGG TCA CCA GAT A - 3'

YNC 198: 5' GGA ATT CTC TGG GTT GGC AGC TGC AGC CTG CCG ATT CCG CTC

TCT TCT AGG AAG CAC TGC CAT TTG TTT ATC TGG TGA CCT TTT

CAG TCT TTT AAT GGT GGC - 3'

YNC 199: 5' CAG GCT GCA GCT GCC AAC CCA GAG AAT TCC AGA GGA AAA GGT

CGG AGA GGC CAG AGG GGC AAA AAC CGG GGT TGT GTC TTA ACT

GCA ATA CAT TTA AAT GTC -3'

YNC 200 GCA AGA GCC GCT GCA GTA CCT AAA AAT CAG TTC CTC CTT

GGT TTC ATA GCC CAG ACC CAA GTC AGT GAC ATT TAA ATG TAT

TGC AGT TAA GAC ACA ACC CCG G - 3'

YNC 205 5 CAG GCT GCA GCT GCC AAC CCA GAG AAT TCC - 3'

YNC 206 5 GGA ATT CTC TGG GTT GGC AGC TGC AGC CTG - 3'

YNC 208 5 GCA AGA GCC GCT GCA GTA CCT AAA AAT CAG - 3'

YNC 201 5 ATG GTA AAC CAG GTT ATC ATC TAA AAA CGA CAG GTC ATC ATC

AAA GGC GAT GGG TCT GCA ACA TGC CTG CCC TAC TTT GTC ACT

CAC CAG CCT TCT ATT TCT - 3'

YNC 202 CTG ATT TTT AGG TAC TGC AGC GGC TCT TGC GAT GCA GCT GAG

ACA ACG TAC GAC AAA ATA TTG AAA AAC TTA TCC AGA AAT AGA

AGG CTG GTG AGT GAC AAA GTA - 3'

YNC 203 : 5' CTG TCG TTT TTA GAT GAT AAC CTG GTT TAC CAT ATT CTA AGA

AAG CAT TCC GCT AAA AGG TGG GGA TGT ATC TGA GTC GAC

Sail AGA TCT ATC GAT TAT GAT - 3' Bglll Clal

YNC 204 ATC ATA ATC GAT AGA TCT GTC CAG TCA GAT ACA TCC ACA CCT

Clal Bglll TTT AGC GGA ATG - 3'

YNC 207 5 CTG ATT TTT AGG TAC TGC AGC GGC TCT TGC - 3'

YNC 209 5 CTG TCG TTT TTA GAT GAT AAC CTG GTT TAC CAT - 3'

YNC 210 5 ATG GTA AAC CAG GTT ATC ATC TAA AAA CGA CAG - 3'

YNC 211 5 ATC ATA ATC GAT AGA TCT GTC CAG TCA GAT - 3'

Clal Bglll

YNC 218 5 ATG TAA GTC GAC AGA TCT TCA TCA - 3'

Sail Bglll

YNC 219 5 ATG TAA GTC GAC AGA TCT TCA TCA CTT GTC ATC GTC GTC CTT

Sail Bglll GTA GTC GAT ACA TCC ACA CCT TTT AGC GGA ATG CTT TCT -

B. Construction of adenoviral and retroviral plasmid vectors including GDNF cDNA

The adenoviral shuttle plasmid vector pAvS6 is described in published PCT Application Nos. W094/23482, published October 27, 1994; W094/29471, published December 22, 1994; and WO95/09654, published April 13, 1995. Wild type human GDNF cDNA, mutant human GDNF cDNA (mutant cDNA generated by the procedure hereinabove described, in which a sequence from nucleotide 509 to nucleotide 544 was deleted) , and the wild type cDNA with the flag sequence, all of which were made by PCR as hereinabove described, each were digested with Xbal and Clal and ligated into Xbal/Clal digested pAvS6 to form pAvS6Gd, pAvS6mGd, and pAvS6GdF, respectively.

The retroviral plasmid vector pGlXSvNa is described in published PCT Application No. WO/09654, published April 13, 1995. The PCR fragments including the wild type human GDNF cDNA and the wild type human GDNF cDNA with the flag sequence each were digested with Notl and Sail, and were cloned into Notl/Sall digested pGlXSvNa to form pGlGdSvNa and pGlGdFSvNa, respectively. The cDNA sequences in the constructs have been confirmed by DNA sequencing.

C. Preparation of recombinant adenoviruses including human GDNF cDNA

Recombinant adenoviruses containing human GDNF cDNA were prepared by co-transfecting 293 cells (ATCC No. CRL 1573) with pAvS6Gd, pAvS6mGd, or pAvS6GdF, and the large fragment of Clal digested Ad dl327 (Thimmappaya, et al . , Cell. Vol. 31, pg. 543 (1983)) DNA. Ad dl327 is identical to Adenovirus 5 (ATCC No. VR-5) , except that an Xbal fragment including bases 28593 to 30470 (or map units 78.5 to 84.7) of the Adenovirus 5 genome (GenBank Accession No. M73260) , and which is located in the E3 region, has been deleted. Through homologous recombination, whereby the two DNA molecules recombine through the homologous fragment from map unit 9.24 to map unit 17.43, the viral vectors AvS6Gd, AvSdGD, and AvS6GdF were generated. Positive plaques have been plaque purified twice and characterized by both PCR and Xbal digestion of Hirt DNA's. (Hirt, J. Mol. Biol.. Vol. 26, pgs. 365-369 (1967)) .

Large quantities of adenoviruses AvS6Gd, AvSdGD, and AvS6GdF were prepared by Cs banding and were titered at 7.1 x IO¹⁰, 3.8 x IO⁹, and 1.2 x 10" pfu/ml, respectively. These viruses were tested for biological activities using cultures derived from fetal rat brain. Cultures of dissociated embryonic day E14.5 rat mesencephalon were established as described by Engele, et al. , J. Neurosc.. Vol. 11, pgs. 3070-3078 (1991) . Cells were plated at 80,000 cells/sq.cm in 48 well plates and grown in N2 serum-free medium. At 24 hours after plating, cultures were infected with 1, 10 or 100 pfu/cell of adenovirus (AvS6Gd, AvSdGD or AvS6GdF) or were not infected (N2 group) . Two hours after infection, cells were washed 3 times and placed in fresh medium. The medium was changed after 4 days. Cultures were fixed in 0.5% glutaraldehyde after 8 days and stained immunocytochemically for tyrosine hydroxylase (TH) , the rate limiting enzyme in DA biosynthesis. The total number of TH positive cells, representing DA neurons was counted in each well and the extent of neurite outgrowth was examined. D. Preparation of amphotropic producer cells which produce retroviral vectors which express human GDNF From 20 μg to 40 μg of plasmids pGlGdSvNa and pGlGdFSvNa were transfected into PE501 cells (Miller, Human Gene Therapy. Vol. 1, pgs. 5-14 (1990)) using the calcium phosphate method. After overnight transfection, the medium was replaced with fresh medium. The transfected cells were cultured continually for another 48 hours. The culture medium was collected, supplemented with 8 μg/ml of Polybrene, and filtered through a 0.22 μ filter. The resulting "transient supernatant" then was used for the following transduction.

About 5 X IO⁴ PA317 cells (Miller, et al. , Mol. Cell. Biol. , Vol. 6, pgs. 2895-2902 (1986)) were seeded in a 100 mm dish one day before transduction. The PA317 cells then were transduced with the "transient supernatant" obtained from the cultures of ecotropic GlGdSvNa or GlGdFSvNa in the presence of 8μg/ml Polybrene for 12 to 24 hours. Forty-eight hours after transduction, the culture medium was replaced with medium containing 0.8 μg/ml of G418. Twenty-four single cell clones transduced with supernatant obtained from cultures of ecotropic GlGdSvNa and thirty-six single cell clones transduced with supernatant obtained from cultures of ecotropic GlGdFSvNa, which expressed human GDNF and human GDNF with the IBI flag peptide at the C-terminus, respectively, were isolated and analyzed by RNA dot blot analysis using the human GDNF cDNA and the neo^R gene, each labeled with ^iZV , as probes The radioactivities were determined by a phosphoimager, and light units are given for each single cell clone in Table I below.

Table I

The four clones from each construct which expressed the highest levels of both GDNF and neo^R message were analyzed further by Northern blot (Figures IA and IB) and Southern blot (Data not shown) analyses . Single cell clones PA317/GlGdSvNa.3, PA317/GlGdSvNa.7, PA317/GlGdFSvNa.5, and PA317/GlGdFSvNa.17 were selected for future studies. These clones contain a similar copy number of integrated proviral genome except for PA317/GlGdSvNa.3, which contains a three fold higher copy number than the rest of the clones. All four clones express a full length transcript (about 3.5 kb) that will be packaged into viral particles and a smaller transcript (about 1.5 kb) that is expressed from the internal SV40 enhancer/promoter. (Figures IA and IB.)

Example 2 In vi tro Studies of GDNF Viral Vectors A. Establishment of DA neuronal bioassays.

In order to establish a bioassay for GDNF, cultures of dissociated E14.5 rat ventral mesencephalon were grown in N2 defined, serum-free conditions, and the effect of cell plating density on the number of tyrosine hydroxylase immunoreactive (TH-IR) neurons, the extent of neurite growth, and high affinity DA uptake after 4 or 8 days in vi tro was assessed. Cultures of dissociated embryonic day E14.5 rat mesencephalon are established as described in Engele, et al., J. Neurosc. , Vol. 11, pgs. 3070-3078 (1991) . Cells are plated at 80,000 cells/sq.cm in 48 well plates and grown in N2 serum-free medium with or without the addition of neurotrophic factors or a source containing neurotrophic factor activity such as viral vectors or medium conditioned by other cell types such as astrocytes, myoblasts, fibroblasts or genetically modified cells. After 4 or 8 days in vi tro, cultures are fixed in 0.5% glutaraldehyde and stained for immunoreactivity to TH. The total number of neurons positive for TH in each well are counted to determine the extent of DA neuronal survival. The extent of neurite outgrowth is determined by counting the number of intersections made by DA fibers with the markings on an ocular grid. Addition of dopaminergic (DA) neurotrophic factors to the medium of these low density cultures produces a dose-dependent increase in DA neuronal survival.

The viral vectors hereinabove described, which harbor GDNF cDNAs were tested to (i) compare the efficacy of the different vectors; (ii) determine whether biological effects on dopaminergic (DA) neurons could be observed; and (iii) identify what types of cells are infected by the vectors. B. Adenoviral infection of neuronal-glial cultures

Primary cell cultures of dissociated E17 rat striatum or E 14.5 mesencephalon were used to assess which cell types are infected with adenovirus and to optimize infection procedures. For striatal cultures, the striatum was dissected out of the E17 embryonic rat brain, dissociated in 0.1% trypsin and passed through a 38 μm mesh filter. Cells were plated at 80,000 cells per sq. cm in 48 well plates and grown in N2 serum-free medium. Cells were infected with AdRSVntLacZ, also known as AdRSV/3 gal, an adenovirus harboring nuclear localized Lac Z provided by Dr. Beverly Davidson at the Univ. of Iowa, and described in Ridoux, et al . , Neuro Report, Vol. 5, pgs. 801-804 (1994), at IO⁴ pfu/cell for 1 hr, 10³ pfu/cell for 4 hr, 10³ pfu/cell for 2 hr, or IO² pfu/cell for 2 hr. At 4 days after infection, cells were fixed in 0.5% glutaraldehyde and stained for β- galactosidase histochemistry and co-stained for a neuronal marker (microtubule associated protein, MAP-2) or an astrocyte marker (glial fibrillary acidic protein, GFAP) . The optimal conditions were found to be infection for 2 hours at an M.O.I. of 100. Double staining for Lac Z histochemistry and MAP-2 showed that under these conditions, 69% of the neurons in the culture expressed the LacZ gene after four days in vi tro. In addition, as shown in Figure 2, double staining using the astrocyte marker, GFAP, showed that approximately 50% of astrocytes also were infected with the adenovirus including the LacZ gene. As shown in Figure 2, the left panel shows three MAP-2 immunoreactive (IR) neurons, two of which had blue stained nuclei for β-galactosidase. The right panel shows blue nuclei in GFAP-IR astrocytes.

To demonstrate specifically that DA neurons are infected by adenovirus, cultures of E14.5 rat mesencephalon, prepared as described above, were infected with AvlLacZ4, described in PCT Application No. WO95/09654 at 100 pfu/cell for 2 hours. At 4 days after infection, cultures were fixed in 0.5% glutaraldehyde. As shown in Figure 3, double staining for β- galactosidase histochemistry and TH-IR (DA neurons) demonstrated that under these conditions DA neurons express the LacZ gene.

In order to determine whether adenoviral vectors harboring cDNAs for GDNF confer bioactive effects on DA neurons, the cultures of E14.5 cells which were infected with the adenoviral vectors hereinabove described were studied at 8 days in vi tro for effects on survival of DA neurons and neurite outgrowth. Statistically significant effects on promoting the survival of DA neurons (as expressed in number of TH-IR neurons) were observed in cell cultures infected with AvS6Gd (195 ± 17) , but not with the mutant GDNF vector AvSdGD (83 ± 12) . The vector AvS6Gd, as shown in Figure 4B, also significantly increased neurite outgrowth from DA neurons . C. Retroviral infection of neuronal-glial cultures and myoblasts

E14.5 mesencephalic cultures, as described above, were used to test retroviral producer cell lines for survival effects on DA neurons. The PA317/GlGdSvNa.3 and PA317/GlGdSvNa.7 producer lines were maintained under G418 selection (200 μg/ml) . Conditioned medium was collected by washing the G418 from the producer cells and replacing the medium with N2 serum free medium. After 24 hours the conditioned medium containing retroviral particles was collected and filtered through a 0.45 μm filter. E14.5 rat mesencephalic cultures were infected 24 hours after plating by replacing the culture medium for 4 hours with medium conditioned by retroviral producer cell lines in the absence of polybrene. Counts of TH-IR neurons at 8 days in vi tro showed that PA317/GlGdSvNa.3 and PA317/GlGdSvNa.7 increased DA neuronal survival in the mesencephalic cultures 2-fold (clone 3: 86±7; clone 7: 83±5; N2-control uninfected cultures: 48±7) .

Human fetal skeletal muscle myoblasts (SKMC cells; Clonetics Catalog, #CC-2561) were transduced in vi tro with retroviral vectors generated from the PA317/GlGdSvNa cell line and collected as described above, but using medium specific for myoblasts (Clonetics Cat. ttCC-4139 plus 2% fetal bovine serum) . Myoblasts (0.4 x IO⁶ cells plated on the day before infection) were infected at 60% confluence in a 100 mm plate with 3 ml of retroviral conditioned medium in the presence of 60 μl polybrene. After selection in G418 for 8 days, the transduced myoblasts were replated in 24 well plates at a density of 3-5 x 10⁵ cells/sq cm. On the next day, rat motor neurons isolated from the E 15 ventral spinal cord using the procedure of Camu, et al. , J. Neurosc. Meth.. Vol. 44, pgs. 59-70 (1992) were plated on top of transduced myoblasts or normal myoblasts as the control at a density of 1 x IO⁴ cells/well. The myoblasts modified with the human GDNF cDNA increased survival of motor neurons four-fold over that in co-cultures with unmodified (normal) myoblasts, thus suggesting that bioactive GDNF is secreted by myoblasts following retroviral infection and selection.

In order to characterize the GDNF transgene protein, PC12 cells (a rat pheochromocytoma cell line; ATCC CRL 1721) were infected with AvlLacZ4, AvS6Gd or AvSdGD in varying amounts of total particles per cell (l.OxlO², 3.2xl0², l.OxlO³, 3.2xl0³ or l.OxlO⁴) . As shown in Figure 5, RT-PCR of total RNA isolated from the PC12 cells revealed increasing mRNA for LacZ and human GDNF that correlated with increasing particles per cell. As shown in Figure 6, Western blot of. PC12 conditioned medium demonstrated secretion of an immunoreactive glycosylated form of GDNF. In addition, a 2- site ELISA of the PC12 conditioned medium showed that PC12 cells under these conditions secrete GDNF at an average rate of about 0.1 picogram per cell per day.

In order to optimize protocols for using adenoviral vectors in the nigrostriatal systems, adult Fisher 344 rats were injected in the striatum with 4 x 10⁵, 4 x IO⁶ or 4 x 10⁷ pfu of AvlLacZ4. The rats were sacrificed at 4 , 30, or 60 days post-infection (DPI) . Low and high magnifications of adenoviral cells 60 days after infection with 4xl0⁶ pfu of AvlLacZ4 are shown in Figure 7. The mean number of total blue nuclei in the striatum for each group of rats (4 rats in each group) were determined, and the results are given in Table II below.

Table I I Titer (pfu)

DPI 4 x IO⁵ 4 x IO⁶ 4 x IO⁷

4 1 , 300 ± 100 3 , 800 ± 1 , 100 15 , 000 ± 2 , 300

30 500 ± 400 3 , 800 ± 700 10 , 000 ±2 , 200

60 800 ± 400 10 , 200 ± 4 , 000 19 , 900 ±2 , 100

Also, a titer of 4 x IO⁷ pfu at 4 days post-infection, an average of 1,170 blue nuclei were observed in the substantia nigra. Double staining revealed 52% of these cells to be TΗ-IR neurons, thus demonstrating retrograde transport of virus or the protein product. (Figure 8)

The above results demonstrate that adenoviral vectors produce biologically active GDNF and deliver stable expression of transgene to cells in the striatum.

Example 3

Conditioned media (CM) of PC 12 cells infected with 300 to 1,000 pfu/cell of AvS6Gd or AvSdGD were prepared. A control group of cells was not infected. 5 days after infection, the medium waε analyzed for human GDNF by ELISA. The ELISA assay was performed by coating capture antibody (3 μg/ml monoclonal anti-human GDNF, R and D Systems, Minneapolis, Minnesota) onto 96 well plates overnight at 4°C in phosphate buffered saline. The wells were blocked with bovine serum albumin (BSA) in PBS for 4 hours at room temperature. Samples (50 μl of CM or serial dilutions of recombinant human GDNF, R and D Systems) were incubated overnight at 4°C. Detection of bound GDNF was by polyclonal anti-human GDNF antibody (2 μg/ml) , incubated overnight at 4°C, followed by horseradish peroxidase-coupled secondary antibody (0.4 μg/ml) for 4 hours at room temperature. 0.02% ABTS (2, 2' -azinobis (3-ethylbenzothiazoline) -6 sulfonic acid diamonium salt, Boehringer Mannheim, Indianapolis, Indiana) and 0.03% H₂0₂ in 0.01 M sodium acetate, pH 5.0, were added and absorbance at 405 nm was measured. 0.5 to 3.2 ng of human GDNF was secreted per IO⁴ infected cells per day, compared to 0 to 0.2 ng from AvSdGD or mock infected cells. DA bioactivity conferred by the vectors was assessed using E14.5 ventral mesencephalon cultures according to the method as described in Engele, et al. , Developmental Biol. , Vol. 152, pg. 363 (1992) . Cultures either were maintained on 50% CM from PC12 cells infected with adenoviral vectors or were infected directly with 10 pfu/cell for 2 hours. Seven days later, cultures were stained for tyrosine hydroxylase immunoreactivity (TH-IR) to identify DA neurons. AvS6Gd led to a 65 to 84% increase in TH-IR numbers, while AvSdGD did not improve survival. (Figure 9) These results confirmed that bioactive GDNF is produced and secreted by cells infected with AvS6Gd.

Example 4

GDNF delivered via an adenoviral vector protects rat midbrain dopaminergic neurons from degeneration following an intrastriatal 6-hydroxydopamine progressive lesion

Fischer 344 male rats (Charles River, Wilmington, MA) , 200-230 g body weight at the beginning of the experiment, were housed in individual cages with ad libi tum access to food and water and kept on a 12 hour light-dark cycle. Rats received bilateral injections into the striatum of 0.2 μl of 2% fluorogold (FG, Fluorochrome, Inc., Englewood, CO) in 0.9% sterile saline at stereotaxic coordinates 1.0 mm anterior, 3.0 mm lateral and 5.0 mm ventral to the bregma using a 1 μl Hamilton syringe with 25 gauge needle at 0.05 μl/min. During the same surgery, replication defective adenoviral vectors encoding GDNF (AVS6Gd, particle ratio 30) or a mutant GDNF (AVSdGD, particle ratio 35) , or AdRSV/3gal (particle ratio 50) were injected immediately dorsal to the right substantia nigra pars compacta (SN) at coordinates 5.3 mm posterior, 1.8 mm lateral and 7.4 mm ventral to the bregma using a 10 μl Hamilton syringe with 26s gauge needle at 0.5 μl/min. Viruses were diluted to 3.2 x IO⁷ pfu in 2 μl with filter sterilized 20% sucrose in 10 mM phosphate buffered 0.9% saline. An additional group of control animals did not receive an injection of virus above the SN. One week following FG and virus injections, 16 μg (calculated as the free base) of 6-hydroxydopamine-HBr (6-OHDA) in 2.8 μl of 0.2 μg/μl ascorbic acid in 0.9% sterile saline was injected into the right striatum at the same coordinates used for the fluorogold injection. For all injections, the needles were left in place 5 minutes following injection prior to removal at 1-2 mm/min. Rats were sacrificed six weeks following the 6-OHDA lesion. A preliminary experiment also was performed with rats receiving either 4%, 2% or 1% bilateral striatal fluorogold (n=3 each) in addition to AvS6Gd (n=5) or AvSdGD (n=4) or AdRSV/3-gal (n=3) above the right SN. These rats were perfused 1 week following FG and virus injections and were analyzed for number of FG positive (FG+) neurons in the dopaminergic cell groups of the midbrain. (The fluorogold and 6-OHDA experimental paradigm is based on that of Sauer, et al., Neuroscience, Vol. 59, pgs. 401-415 (1994)) .

All rats were perfused with 100 ml of 0.9% saline with 0.002% sodium nitrite followed by 300 ml of 4% paraformaldehyde in 0.1 M phosphate buffer (PB) , pH=7.4. Brains were removed and post-fixed in 4% paraformaldehyde and 5% sucrose in PB overnight, and cryoprotected in 10, 20 and 30% sucrose in PB. Brains were sectioned with a sliding microtome at 40 μm through the striatum and 25 μm through the SN. Tyrosine hydroxylase (TH) immunofluorescence, or immunocytochemistry with 1:1,000 TH antibody was used to visualize dopaminergic fibers in the striatum with diaminobenzidine (DAB) staining with nickel enhancement. As a measure of the effect of treatment on the number of surviving neurons in the SN that project to the lesioned region of the striatum, the number of fluorogold positive (FG+) neurons was determined at the level of the medial terminal nucleus of the accessory optic tract (MT nucleus) in the SN. LacZ transgene expression was followed by histochemistry with X-gal (5-bromo-4-chloro-3-indoyl-B-D- galactopyranoside) (Cepko, Molecular Neurobiological Techniques. Boulton, et al. , eds., Vol. 16, pg. 177 (1990)) .

At one week after injection of FG, significant damage in the striatum was observed following 4% FG, with considerably less at 2% and 1%. Therefore, 2% FG was chosen for the long term survival experiment. Large numbers of FG+ neurons were observed in the SN, mainly located medially and ventrally. Fewer FG+ neurons were noted in the A8 cell group and ventral tegmental area (VTA) . The number of FG+ neurons was determined in every 7th section through the rostrocaudal extent of the midbrain dopaminergic cell groups. The ratio of FG+ neurons on the right (Ad injected) /left (uninjected) side was 0.97+0.04 (n=5) for the AvS6Gd group and 1.04±0.06 (n=4, mean ± sem) for the AvSdGD group, and 0.99±0.11 for the AdRSV/3-gal group, demonstrating that GDNF, mutant GDNF, and LacZ did not affect the initial retrograde labelling of dopaminergic neurons with FG (p>0.3, t tests, H_o:μ=1.0) .

At six weeks following injection of 6-OHDA, a loss of TH immunoreactive (TΗ-IR) fibers was noted surrounding the site of injection of FG and 6-OHDA in the right striatum, limited largely to the dorsolateral striatum. Little damage was noted in the left striatum, which received FG only. Therapy with AvS6Gd significantly protected DA neurons from cell death following the striatal 6-OHDA lesion. The ratio of FG+ neurons on the right (Ad injected) /left side at the level of the MT nucleus in the SN was 0.89±0.20 for AvS6Gd (n=5) , 0.27+0.04 for AvSdGD (n=5) , and 0.49±0.11 for no virus (n=4) (p<0.03 one way analysis of variance,- Fisher's post hoc pairwise comparisons yielded p<0.007 for GDNF vs. mutant GDNF, p<0.065 for GDNF vs. no virus, and p>0.3 for mutant GDNF vs. no virus) . These results also are shown in Figures 10 and 11.

Furthermore, TH immunofluoroescence revealed most large FG+ cells to be TH+, i.e., dopaminergic (Figure 12A) . 42 days after 6-OHDA, a loss of TH-IR fibers was observed surrounding the striatal injection site (Figure 12B) . There were no obvious differences in the size and appearance of the striatal lesions among experimental groups. The number of FG+ cells with cross-sectional area larger than approximately 40 μm² was determined in every seventh section through the rostrocaudal extent of the midbrain dopaminergic cell groups (SN, VTA, and A8) . Therapy with AvS6Gd protected FG+ DA neurons from cell death following striatal 6-OHDA lesion. (Figures 12C through 12G) . The mean numbers of large FG+ cells on the lesioned (L) and unlesioned (U) sides of each group of rats were as shown in Table III below. TABLE III

AvS6Gd AdRSVβgal AvSdGD no virus

L 620±55 209±28 208±40 327±25

U 799±76 852±32 779±56 822±86

In rats treated with AvSdGD or AdRSVjSgal, and in untreated rats, there were more small FG+ cells within and around the substantia nigra. These cells were not TH+ . Many of these cells have the classic morphology of microglia which have phagocytosed FG+ neuronal debris and subsequently migrated away from the site of neuronal degeneration (Sauer, et al., Neuroscience, Vol. 59, pg. 401 (1994)) , aε also reported following facial and vagal nerve axotomy. (Angelov, et al., Glia, Vol. 13, pg. 113 (1995) ; Rinaman, et al . , Neuroscience. Vol. 44, pg. 765 (1991) .)

Stability of infection and transgene expression was investigated at the DNA, mRNA, and protein level. X-gal staining of rats injected with AdRSVβgal revealed blue nuclei within 0.8 to 1.0 mm of the injection site, through most of the rostrocaudal extent of the substantia nigra (Figure 12H) . DA neurons with blue nuclei were observed occasionally (insert Figure 12H) . Expression declined from 39,000±5,200 (n=3) blue nuclei at 10 days to 7,100±l,400 (n=3) at 49 days. ELISA, RT-PCR, and PCR were performed at 1 and 4 weeks following AvS6Gd or AdRSVβgal injection (before and 3 weeks after 6-OHDA) on protein, RNA, and DNA, respectively, isolated from tissue surrounding the site of adenoviral vector injection. Tissue taken from the ventral mesencephalon of rats sacrificed by C0₂ suffocation was sonicated in 9 volumes of PBS, 0.1% Tween-20, 0.5% BSA, 2mM EDTA, and protease inhibitors; centrifuged at 40,000 xg for 12 minutes, and the supernatant was used for ELISA assays for GDNF as hereinabove described in Example 3, and for β- galactosidase (5 Prime → 3 Prime, Inc., Boulder, Colorado) . RNA and DNA were isolated from the pellet using Tri Reagent (Molecular Research Center, Inc., Cincinnati, Ohio) . RT-PCR and PCR with β-actin were performed as described in Choi- Lundberg, et al . , Dev. Brain Res.. Vol. 85, pg. 80 (1995) , except PCR conditions were 94°C, 30 seconds; 52°C, 45 seconds, and 72°C, 45 seconds. GDNF primers which recognize human, but not rat, GDNF (5' -GATAAACAAATGGCAGTGCT and 5'- AGCCTTCTATTTCTGGATAA) yielded a 269 bp product with PCR conditions of 94°C, 30 seconds; 56°C, 45 seconds, and 72°C, 30 seconds. LacZ primers were those described in Lu, et al., Hepatology, Vol. 21, pg. 752 (1995) . PCR products from the linear range of amplification were quantified from ethidium bromide stained gels with NIH Image.

At 1 week, 13± 1 ng GDNF and 52±22 ng β-galactosidase, and at 4 weeks, 4.7±0.9 ng and 20±0.3 ng, respectively, were present in the ventral mesencephalon. Similar decreases were observed in transgene mRNA, while transgene DNA levels were unchanged, as shown in Table IV below, suggesting downregulation of the promoter, but not the loss of adenoviral vector infected cells .

Table IV

Protein RNA DNA

Weeks post-vector

Vector iniection % ng i % AvS6Gd 1 100±7 13±1 100±7 100±4

4 36±7 4.7±0.9 54±4 82±8

AdRSVβgal 1 100±38 57±22 100±17 100±14

4 35±1 20±0.3 40±2 126±5

The comparable changes in GDNF and β-galactosidase expression suggest host responses to AvS6Gd and AdRSVøgal were similar.

Nissl stained sections also were scored for the degree of cellular reaction around the needle track and substantia nigra 49 days after adenoviral vector administration. All rats had mild reactions around the needle track, as shown in Figures 13A through 13C. Near the substantia nigra, no. host reaction was observed in 1 of 3 rats given AdRSVβgal, in 1 of 6 rats given AvS6Gd, and in no rats given AvSdGD. A mild reaction was observed in 2 of 3 rats given AdRSVβgal, in 3 of 6 rats given AvS6Gd, and in 3 of 5 rats given AvSdGD. A moderate reaction was observed in no rats given AdRSV_/Sgal, in 2 of 6 rats given AvS6Gd, and in 2 of 5 rats given AvSdGD. (Figures 13D through 13F) . Notably, host reactions to the vectors were similar regardless of the encoded transgene.

These results demonstrate that GDNF, delivered via a replication defective adenoviral vector at a site immediately dorsal to the substantia nigra pars compacta, is able to protect a large percentage of neurons from degeneration after exposure of their terminals to striatal 6-OHDA. 69±3% of FG- labeled DA neurons degenerated in the AdRSVjSgal, AvSdGD and uninjected groups, compared to only 2l±5% in AvS6Gd treated animals. The adenoviral vectors had similar titers and particle ratios, and host responses to the vectors were similar. Thus, the success of AvS6Gd and failure of AvSdGD and AdRSV/3gal to protect DA neurons can be attributed to production of GDNF protein by host tissue modified by AvS6Gd. The dissociation constants (K_d) for GDNF binding to its receptors, GDNFR-α and c-ret, which are expressed in the adult rat substantia nigra, are in the range of 2 to 300 pM (Durbec, et al. , Nature. Vol. 381, pg. 789 (1996); Jing, et al., Cell. Vol. 85, pg. 1113 (1996); Treanor, et al. , Nature, Vol. 382, pg. 80 (1996); Trupp, et al. , Nature. Vol. 381, pg. 785 (1996) ) , and the half maximal effective concentration (EC₅₀) of GDNF in embryonic dopaminergic neurons in culture is lpM (40 pg/ml) . (Lin, et al. , Science. Vol. 260, pg, 1130 (1993) .) In this example, 13 ng of human GDNF was present in the vicinity of the substantia nigra at the time of the 6- OHDA lesion, and 4.7 ng at 3 weeks after the lesion, amounts which are more than adequate to activate GDNF receptors on DA neurons . In addition, Sauer et al. , Proc. Nat. Acad. Sci... Vol. 92, pgs. 8935-8939 (1995) have demonstrated that administration of 10 μg of recombinant human GDNF injected above the SN every other day for 4 weeks (140 μg cumulative dose) beginning on the day of striatal 6-OHDA lesion fully protected the FG+ cells in the SN. Based on ELISA data of cells infected with AvS6Gd (Ad GDNF) , approximately 1000-fold less GDNF was administered in this study. However, this level of less biosynthetically produced GDNF is able to protect DA neurons from cell death in a rat model of Parkinson's Disease. Consequently, this adenoviral vector is able to deliver biologically effective concentrations of neurotrophic factors .

Delivery of GDNF by in vivo gene therapy rather than repeated injection or infusion has several advantages. Gene therapy is less invasive and can deliver continuously a neurotrophic factor that is biologically synthesized, processed, and secreted. Gene delivery can be located near degenerating neuronal soma or target neurons. Further specificity in delivery could be effected through the use of a cell-specific promoter, such as the tyrosine hydroxylase promoter, which would produce selectively neurotrophic support in DA neurons in an autocrine or paracrine manner, or a promoter specific to DA target neurons in the striatum, such as enkephalin or substance P. Alternatively, an astrocyte specific promoter may be used to increase neurotrophic factor expression in the vicinity of DA neurons. GDNF and its receptors are expressed throughout the CNS and periphery (Treanor, et al., 1996; Trupp, et al. , 1996, Arenas, et al . , Neuron, Vol. 15, pg. 1465 (1995); Bello, et al., Neuron, Vol. 15, pg. 821 (1995); Ebendal, et al. , Neurosci. Res. , Vol. 40, pg. 276 (1995); Henderson, et al., Science, Vol. 266, pg. 1062 (1994); Mount, et al. , Proc. Nat. Acad. Sci.. Vol. 92, pg. 9092 (1995); Trupp, et al. , J. Cell. Biol.. Vol. 130, pg. 137 (1995); Choi-Lundberg, et al. , Dev. Brain Res. , Vol. 85, pg 80 (1995)). Therefore, localized gene therapy is likely to minimize deleterious side effects that may result from exposure of other cells to excess GDNF.

Example 5

Striatal GDNF delivered via an adenoviral vector prevents the development of amphetamine-induced rotation behavior following striatal 6-OHDA lesion

Rats received bilateral injections of fluorogold into the striatae as hereinabove described in Example 4 in order to label retrogradely a subpopulation of DA neurons in the substantia nigra. AvS6Gd (3.85 x IO⁷ or 3.2 x IO⁷ pfu), AdRSVjSgal (3.2 x 10⁷ pfu), AvSdGD (2 x IO⁷ pfu), or vehicle (20% sucrose in PBS) was injected unilaterally into the striatum 1.2 mm from the FG injection site. An additional group of rats received no additional injection into the striatum. One week later, 16 μg of 6-OHDA was injected unilaterally into the striatum at the same site as the FG injection and on the same side as the adenoviral vector in_jection. The rats then were tested for amphetamine-induced rotation behavior according to the method of Ungerstedt, Acta Phvsiol. Scand.. Vol. 82, pgs. 69-93 (1971) . Amphetamine- in_duced rotation behaviors were recorded in automated rotometer chambers (Rota-Dac, Datak Systems, Webster, New Yor_k) for 90 minutes following injection of 6.8 mg DL- amphetamine sulfate per kg body weight (equivalent to 5 mg/kg _free base) . Data from the AvSdGD and AdRSVjSgal control groups (n=15) was pooled for analysis, as was data from the vehicle and no injection groups (n=ll) , and compared to the _AvS6Gd group (n=16) . As shown in Figure 14, 9 to 12 days _fol_lowing the administration of 6-OHDA, the rats treated with the control vectors or no vectors exhibited rotations toward the lesioned side (*) , while the AvS6Gd treated rats did not _differ significantly from prelesion {#) . Also, the AvS6Gd treated rats exhibited significantly fewer rotations than the control vector groups, but not compared to the no vector group. At 23-26 days and 37-40 days after 6-OHDA administration, the AvS6Gd treated rats still did not exhibit rotation toward the lesioned side,- however, the rats treated with control vectors or no vector exhibited a diminished level of rotation that was not significantly different from AvS6Gd treated rats or prelesion values. Because the 6-OHDA lesion used in this example was partial, improvement at later time points is likely to be the result of spontaneous recovery of lesioned dopaminergic fibers and/or upregulation of the DA system in unlesioned fibers. Another behavioral test of dopaminergic function also demonstrated efficacy of the AvS6GD treatment. Rats were videotaped for forepaw use during spontaneous rearing behavior in a plexiglass container at 9-12 days following administration of 6-OHDA. In this test, rats with a dopaminergic lesion prefer to land on their paw ipsilateral to the lesion. Scoring of the % ipsilateral paw and % of contralateral paw use was determined in a blind experimental design. Vehicle and LacZ treated control rats favored their ipsilateral paw (% ipsilateral minus % contralateral = 0.23 ± 0.06 S.E.M.) . In contrast, rats that received AvS6GD did not develop a bias for using their ipsilateral paw (% ipsilateral minus % contralateral = -0.07 ± 0.06 S.E.M.;' t=2.96, 0.008 compared to control groups; Student's 2-sample t-test) . These behavioral observations are important in that they demonstrate that function of the nigrostriatal DA system is maintained by treatment with AvS6Gd in the 6-OHDA lesioned rat. While the human brain is more complex than that of the rat brain, the human nigrostriatal system is very similar to that of the rat anatomically and also relies on DA for normal functioning. Deficits of dopamine in the human striatum are correlated with loss of motor control specifically displayed by patients as tremor, rigidity, and bradykinesia. Treatment of rats with AvS6Gd also increased extent of DA cell survival as determined by counting FG labeled neurons in every sixth section through the rostrocaudal extent of the midbrain dopaminergic cell groups (SN, VTA, and A8) . At six weeks following injection of 6-OHDA, the mean numbers of FG+ neurons on the lesioned and unlesioned sides are shown in Table V below. Analysis of variance on the lesioned side (F- 9.44, p<0.00l) followed by Tukey' s posthoc pairwise comparison showed the mean number of FG+ cells in AvS6Gd treated rats to be significantly higher than the 4 control groups at p<0.003. Analysis of variance on the unlesioned side showed no significant difference in the number of FG+ cells in any of the groups (F=2.91, p=0.04) .

TABLE V

Experimental Group Number of Mean number S.E.M rats of FG+ cells

Lesioned

AvS6Gd (GDNF) 11 557 45

AdRSVβgal 5 315 21

AvSdGD (Mutant) 6 332 41

No treatment 10 313 29

Vehicle injection 5 321 24

Unlesioned

AvS6Gd (GDNF) 11 887 59

AdRSVjSgal 5 1068 61

AvSdGD (Mutant) 6 872 62

No treatment 10 799 55

Vehicle injection 5 1038 73

The percentage of FG+ cells on the lesioned side compared to the unlesioned side for each group showed that treatment of rats with the GDNF vector (AvS6GD) significantly increased the survival of DA neurons following 6-OHDA by approximately 2-fold (see Table VI below) . Because the percentage of FG+ cells on the lesioned side compared to the unlesioned side in rats injected with control vectors, vehicle, or nothing were not significantly different, these groups were pooled for statistical analysis. A one-way analysis of variance (F-19.13,p<0.001) followed by Tukey' s post-hoc pairwise comparison showed that treatment with AvS6Gd was significantly less than controls at p<0.001.

TABLE VI

Experimental Group Number of Mean ratio of S.E.M. rats FG+ cells on lesioned side / FG+ cells on unlesioned side

AvS6Gd (GDNF) 11 64 5

AdRSV/3gal 5 30 3

AvSdGD (Mutant) 6 38 3

No treatment 10 41 4

Vehicle injection 5 31 1

The levels of human GDNF protein were determined by ELISA at 1 and 7 weeks after injection of vector in both striatum (the site of vector injection) and in the ventral mesencephalon (the location of DA neurons) . These measurements showed that nanogram levels of GDNF protein in the striatum at both 1 and 7 weeks persist without any significant decrease over time (see Table VII below) . In the ventral mesencephalon, picogram levels of human GDNF protein were present at 1 week. At 7 weeks, 50 pg of GDNF was assayed in the mesencephalon of one rat, whereas it was undetectable in the mesencephalon of 4 rats. These resultε suggest that transgene expression is not downregulated when vector is injected into the striatum. Furthermore, they suggest that the GDNF protein secreted by cells expressing transgene is taken up by DA terminals and retrogradely transported to the DA neurons in the mesencephalon, and/or that some vector is retrogradely transported to DA neurons where GDNF protein is synthesized.

TABLE VII

Brain region and Mean amount of S.E.M. survival time after GDNF protein vector injection by ELISA

Striatum

1 week 14 ng 3 7 weeks ll ng 1 Ventral Mesencephalon l week 25 pg 10

7 weeks 10 pg 10

Example 6 Primary astrocytes purified from postnatal day 1 rat cortex and glial cell lines generated from fetal mesencephalic glia were transduced with the adenoviral vector AvS6Gd (at 3.5xl0⁴ particles/cell) or the retroviral vector GlGdSvNa. When the retroviral vector was used, 2 ml of retrovirus conditioned medium was incubated with 4 x 10⁵ cells two times per day, 4 hours each time, for 2 days, with 8μg/ml Polybrene. Viruses including the ^-galactosidase gene, the adenoviral vector AdRSVj3gal, and the retroviral vector GlBgSvNa, were used to assess transfection efficiency. An ELISA as hereinabove described in Example 3 , that specifically recognizes human, but not rat, GDNF was used to determine the amount of GDNF in glial conditioned media. All glial types infected with GlGdSvNa secreted nanogram amounts of GDNF (2.5-10ng/10⁶ cells/24 hours) . Primary astrocytes infected with AvS6Gd secreted much higher levels (124.7 ng/10⁶ cells/24 hours) . Human GDNF was not detected in cells infected with AdRSVjSgal or GlBgSvNa. These results show that primary and glial cell lines may be modified genetically to secrete high levels of GDNF, and that glial cells may be used for delivering trophic support to neurons as therapies for a variety of neurodegenerative conditions, including Parkinson's disease.

Example 7 Schematics of the construction of pAvGdnBg02i are shown in Figures 15A and 15B. Firstly, plasmid pAvS6Gd was digested with Ndel and Csp45I, the ends were filled in with Klenow, followed by blunt end ligation to form pAvS19Gd. pAvS19Gd then was digested with Bglll. An internal ribosomal entry site, or IRES, from encephalomyocarditis virus, was obtained by PCR from plasmid pEMC-F (Figure 16) by PCR .using the following primers:

CH8.1294: 5' - TGA TGT GTA GAT CTT GGT ATT ATC GTG TTT TTC AAA GG -3' CH9.1294: 5' - AGT GTG CTG GAT CCT CTC GAG CGG GAT CAA TTC - 3'

The resulting 591 bp fragment including the IRES included BamHl and Bglll sites at its 5' and 3' ends, respectively. The fragment was digested with BamHl and Bglll and ligated to the Bglll digested pAvS19Gd to form pGde. (Figure 15A.)

Plasmid pGde then was digested with Notl and Bglll, and a Notl/Bglll fragment including an adenoviral 5' ITR, an adenoviral packaging signal, a Rous Sarcoma Virus promoter, human GDNF cDNA, and an internal ribosomal entry site was ligated into Notl/BamHI digested pAvS6nLacZ (also known as ps6anlacZ, described in published PCT application No. W095/ 09654) to form pAvGdnBg02i (Figure 15B) . A map of plasmid pAvGdnBg02i also is shown in Figure 17.

293 cells were co-transfected with pAvGdnBg02i and the large fragment of Clal digested Ad dl 327. Through homologous recombination, the two DNA molecules recombine through the homologous fragment from map unit 9.24 to map unit 17.43 to generate the viral vector AdGDNF-ires-LacZ. Positive plaques have been plaque purified twice and characterized by both PCR and Xbal digestion of Hirt DNA's. (Hirt, 1967.)

Young adult Fischer 344 male rats were injected with 2x10⁶ pfu AdGDNF-ires-LacZ in the striatum in 8μl distributed between two needle tracks at coordinates of 0.7 mm anterior, 2.5 mm lateral, and 5.5 and 4.5 mm ventral to bregma, and 0.2 mm posterior, 3.5 ram lateral, and 5.5 and 4.5 mm ventral to bregma. At 4, 30, or 60 days after injection, rats were sacrificed by C0₂ inhalation, and both striatae of each sacrificed rat were dissected. RNA and DNA were isolated using Tri Reagent (Molecular Research Center, Inc., Cincinnati, Ohio) following the manufacturer's instructions. RT-PCR and PCR were performed on RNA and DNA, respectively. RT-PCR and PCR were performed essentially as described in Choi-Lundberg, et al . , 1995. PCR conditions with 0-actin primers were 94°C, 30 seconds; 52°C, 45 seconds,- and 72°C, 45 seconds. Primers which recognize human, but not rat, GDNF were 5' -GATAAACAAATGGCAGTGCT and 5' -AGCCTTCTATTTCTGGATAA, and yield a 269 bp product, with conditions of 94°C, 30 seconds, 56°C, 45 seconds; and 72°C, 30 seconds. LacZ primers and conditions were as described in Lu, et al., Hepatology, Vol. 21, pg. 752 (1995) .

As shown in Figure 18, LacZ RT-PCR products were observed on the injected side at 4, 30, and 60 days with primers to LacZ and with reverse transcriptase (RNA:LacZ+) , indicating expression of LacZ mRNA. When reverse transcriptase is left out of the reaction, no RT-PCR products are observed (RNA:LacZ-) , demonstrating that the products obtained with reverse transcriptase (RNA:LacZ+) are from RNA and not from any contaminating DNA. Similarly, LacZ PCR products are observed on the injected side at 4, 30, and 60 days (DNA:LacZ) , indicating persistence of vector DNA. RT- PCR with jS-actin primers shows consistent RNA integrity (RNA:/3-actin+) . 30 cycles of PCR were performed for all reactions, except 20 cycles for jS-actin.

Figure 19 shows the results of RT-PCR or PCR on RNA (Panels A-C) and PCR on DNA (Panels D and E) from the injected and uninjected sides at 60 days, or on a water blank. Panel A shows the results of RT-PCR with human GDNF primers and reverse transcriptase, demonstrating the expression of transgene GDNF mRNA. Panel B shows the results of PCR with human GDNF primers without reverse transcriptase, indicating that the bands in Panel A were obtained from RNA and not contaminating DNA. Panel C shows the results of RT- PCR with β -actin primers, as a control for RNA integrity. Panel D shows the results of PCR on DNA, and employing human GDNF primers, showing the persistence of GDNF transgene DNA. Panel E shows the results of PCR on DNA, and employing β- actin primers, as a control for DNA integrity. 25 cycles of PCR were performed for all reactions, except for Panel C, where 20 cycles of PCR were performed.

The disclosure of all patents, publications, (including published patent applications) , and database accession numbers, and depository accession numbers referenced in this specification are specifically incorporated herein by reference in their entirety to the same extent as if each such individual patent, publication, and database accession number, and depository accession number were specifically and individually indicated to be incorporated by reference.

It is to be understood, however, that the scope of the present invention is not to be limited to the specific embodiments described above. The invention may be practiced other than as particularly described and still be within the scope of the accompanying claims.

Claims

WHAT IS CLAIMED IS:

1. A viral vector including a polynucleotide encoding a neurotrophic factor selected from the group consisting of glial cell line derived neurotrophic factor, NT-4/5, NT-3, and CNTF, and derivatives and analogues thereof.

2. The vector of Claim 1 wherein said neurotrophic factor is glial cell line derived neurotrophic factor.

3. The vector of Claim 1 wherein said viral vector is a retroviral vector.

4. The vector of Claim 1 wherein said viral vector is an adenoviral vector.

5. The vector of Claim 1 wherein said viral vector is an SV40 vector.

6. A method of treating amyotrophic lateral sclerosis, comprising: administering to a host a viral vector including a polynucleotide encoding a neurotrophic factor, said viral vector being administered in an amount effective in treating amyotrophic lateral sclerosis in said host.

7. The method of Claim 6 wherein said neurotrophic factor is selected from the group consisting of glial cell line derived neurotrophic factor, BDNF, NT-4/5, NT-3, CNTF, IGF, cardiotropin, and hepactocyte growth factor.

8. The method of Claim 7 wherein said neurotrophic factor is glial cell line derived neurotrophic factor.

9. The method of Claim 6 wherein said viral vector is a retroviral vector.

10. The method of Claim 9 wherein said retroviral vector is administered in an amount of from about IO⁵ cfu/ml to about IO⁷ cfu/ml.

11. The method of Claim 6 wherein said viral vector is an adenoviral vector.

12. The method of Claim 11 wherein said adenoviral vector is administered in an amount of from about 10⁵ pfu/ml to about 5 x 10¹⁰ pfu/ml.

13. A method of treating Parkinson's Disease, comprising: administering to a host a viral vector including a polynucleotide encoding a neurotrophic factor selected from the group consisting of glial cell line derived neurotrophic factor, NT-4/5, NT-3, and TGF-0, said viral vector being administered in an amount effective in treating Parkinson's Disease in a host.

14. The method of Claim 13 wherein said neurotrophic factor is glial cell line derived neurotrophic factor.

15. The method of Claim 13 wherein said viral vector is an adenoviral vector.

16. The method of Claim 15 wherein said adenoviral vector is administered in an amount of from about IO⁸ pfu to about 5 x IO¹⁰ pfu.

17. A method of treating amyotrophic lateral sclerosis, comprising: administering to a host cells transduced ex vivo with a polynucleotide encoding a neurotrophic factor, said cells being administered in an amount effective to treat amyotrophic lateral sclerosis in a host.

18. The method of Claim 17 wherein said neurotrophic factor is selected from the group consisting of glial cell line derived neurotrophic factor, BDNF, NT-4/5, NT-3, CNTF, IGF, cardiotropin, and hepotocyte growth factor.

19. The method of Claim 18 wherein said neurotrophic factor is glial cell line derived neurotrophic factor.

20. The method of Claim 17 wherein said cells are myoblasts .

21. The method of Claim 17 wherein said cells are transduced with a viral vector including said polynucleotide encoding a neurotrophic factor.

22. The method of Claim 21 wherein said viral vector is a retroviral vector.

23. The method of Claim 21 wherein said viral vector is an adenoviral vector.

24. A method of treating Parkinson's Disease in a host, comprising: administering to a host cells transduced with a polynucleotide encoding a neurotrophic factor selected from the group consisting of glial cell line derived neurotrophic factor, NT-4/5, NT-3, and TGF-β, said cells being administered in an amount effective to treat Parkinson's Disease in said host.

25. The method of Claim 24 wherein said neurotrophic factor is glial cell line derived neurotrophic factor.

26. The method of Claim 24 wherein said cells are selected from the group consisting of astrocytes, fibroblasts, myoblasts, glial cells, and progenitor cells.

27. The method of Claim 24 wherein said cells are transduced with a viral vector including said polynucleotide encoding said neurotrophic factor.

28. The method of Claim 27 wherein said viral vector is a retroviral vector.

29. The method of Claim 27 wherein said viral vector is an adenoviral vector.

30. The method of Claim 24 wherein said cells are administered in an amount of from about lxlO⁸ to about 5xl0¹⁰ cells .